Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print October 3, 2007.
Biol Reprod 2007, 10.1095/biolreprod.107.063537
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/1/176    most recent
biolreprod.107.063537v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Diaz, F. J
Right arrow Articles by Eppig, J. J
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Diaz, F. J
Right arrow Articles by Eppig, J. J
Agricola
Right arrow Articles by Diaz, F. J
Right arrow Articles by Eppig, J. J
BIOLOGY OF REPRODUCTION 78, 176–183 (2008)
DOI: 10.1095/biolreprod.107.063537
© 2008 by the Society for the Study of Reproduction, Inc.

Gamete Biology; 

Regulation of Pcsk6 Expression During the Preantral to Antral Follicle Transition in Mice: Opposing Roles of FSH and Oocytes1

Francisco J Diaz , Koji Sugiura , and John J Eppig 2

The Jackson Laboratory, Bar Harbor, Maine 04609

ABSTRACT

Several secreted products of the TGFbeta superfamily have important roles during follicular development and are produced by both oocytes and somatic cells (granulosa and theca) in the follicle. The proprotein convertases are a family of seven known proteins that process TGFbeta ligands and other secreted products to their mature active form. The present study examined the regulation of steady-state levels of Pcsk6 mRNA, which encodes a convertase protein known to process members of the TGFbeta superfamily, during mouse follicular development. Pcsk6 mRNA and protein were expressed in preantral but not cumulus or mural granulosa cells. Pcsk6 mRNA levels in preantral granulosa cells were not regulated by growing oocytes of preantral follicles, but were elevated by FSH. Furthermore, Pcsk6 mRNA in preantral granulosa cells was potently suppressed by factor(s) secreted by fully grown oocytes from antral follicles, in part through SMAD2/3-mediated pathways. Oocytes acquired the ability to suppress the steady-state levels of Pcsk6 mRNA in granulosa cells during the preantral to antral follicle transition. Suppression of Pcsk6 mRNA by oocytes could reflect a change in the mechanism(s) regulating the activity of members of the TGFbeta superfamily.

cumulus cells, convertase, follicle, follicular development, gamete biology, granulosa, granulosa cells, oocyte, oocyte development

INTRODUCTION

Ovarian follicular growth and development is dependent on both locally produced hormones and growth factors and gonadotropins from the pituitary. Intercommunication between the granulosa cells and the oocyte is a crucial aspect of the local control of follicle growth [1]. Oocytes stimulate glycolysis [2], proliferation [3, 4], amino acid transport [5], and survival [6] of companion granulosa cells. These effects of oocytes are mediated, in part, through production of secreted factors of the TGFβ superfamily of proteins [7–10]. The granulosa cells also regulate oocytes and their own growth and development through the production of intraovarian factors, which include activins, inhibin, AHM, KITL, and BMPs [7, 8, 11–16]. Thus, autocrine and paracrine signals from oocytes and granulosa cells are important for follicular development.

Many of the intraovarian regulators of folliclular and oocyte development belong to the TGFβ superfamily of proteins. These include activin, AMH, various BMPs, GDF9, and TGFB [7–11]. Initially, these are produced as proproteins that must be cleaved by specific proteases to produce mature active forms. The proprotein convertases (PCs) are a family of proteins that mediate the processing of secreted, cell surface, and transmembrane proteins [17]. There are seven known convertase proteins that cleave at basic amino acid residues with a (K/R)-(X)n-(K/R) motif, where n = 0, 2, 4, or 6 residues [17]. This motif is present in the unprocessed form of TGFβ family proteins involved in follicular development, indicating that these products must be processed to achieve full biological activity [17]. Pcsk1 and Pcsk2 are mainly expressed in neuroendocrine tissues and pancreas [18, 19], whereas Pcsk4 is specific to the testes with slight staining of interstitial cells in the ovary [20, 21]. Conversely, Furin and the closely related Psck6, along with Pcsk5 and Psck7, are more widely expressed [22–26]. In preliminary studies, we found that in contrast to other convertase proteins, high expression of Pcsk6 in preantral follicles and low expression in antral follicles. Thus, Pcsk6 may play an important role during the preantral to antral follicle transition.

TGFβ proteins are processed by at least four of the convertase proteins (FURIN, PCSK5, PCSK6, and PCSK7) [24, 25, 27]. Given that convertase proteins are required for producing active forms of important TGFβ ligands present in the ovary, we sought to determine their spatial and temporal regulation during follicular development. The present study examined the regulation of Pcsk6, which is highly expressed in preantral granulosa cells but not in fully differentiated cumulus cells, during follicular development in the mouse, with special attention to regulation by oocytes and/or FSH.

MATERIALS AND METHODS

Animals

Female B6SJLF1 mice were produced and raised in the research colony of the investigators at The Jackson Laboratory and were used for all experiments. Ovaries from unprimed 12, 14, 16, 18, and 20-day-old animals, from 20-day-old animals injected with 5 IU of eCG (48 h), or eCG-primed animals injected with hCG (8 h) were used for all experiments. The eCG and hCG were obtained from the National Hormone and Peptide Program, NIDDK. Animals were maintained according to the Guide for the Care and Use of Laboratory Animals (Institute for Learning and Animal Research).

Isolation of Oocytes, Cumulus-Oocyte Complexes (COCs), and Granulosa Cells

Cumulus-oocyte complexes (COCs) at the germinal vesicle (GV) stage were collected from antral follicles by gentle puncture with a syringe and needle. Oocytectomized cumulus complexes (OOX) were obtained by microsurgical extirpation of the oocyte from the COCs, as previously described [28]. Mural granulosa cells were collected from eCG-primed female mice after puncture of the follicle with a syringe and needle. Fully grown oocytes from eCG-primed female mice, and Day 16 and Day 18 oocytes from small and large antral follicles, respectively, were isolated by follicle puncture and gentle pipetting of the COCs. Preantral-oocyte complexes (POCs) and growing oocytes were collected from immature animals on Day 12 or 14 after birth using collagenase digestion as described previously [29–31]. Preantral granulosa cells were isolated by passing POCs through a small-bore glass pipette to separate granulosa cells from the mid-growth stage (growing) oocytes. Oocytes from preantral follicles (Days 12 and 14) were collected by collagenase digestion and gentle pipetting as described previously [29–31].

Culture of COCs and Granulosa Cells

COCs, POCs, and preantral granulosa cells (oocytectomized POCs) were cultured under oil for 15 h in 25-µl drops of bicarbonate-buffered MEM-{alpha} (Life Technologies, Inc., Grand Island, NY) with Earles salts, supplemented with 75 mg/L penicillin G, 50 mg/L streptomycin sulfate, 0.23 mM pyruvate, and 3 mg/ml crystallized lyophilized bovine serum albumen. Some cultures of POCs or preantral granulosa cells were cocultured with fully grown oocytes (2 oocytes/µl), Day 18 oocytes (2 oocytes/µl), Day 16 and Day 14 oocytes (3 oocytes/µl), or Day 12 oocytes (4 oocytes/µl) for 15 h. Different numbers of oocytes were used for the different ages to compensate for oocyte size differences [32]. In addition to oocyte coculture, some groups of POCs were treated with FSH (0.5 IU/ml). Some cultures of POCs were pre-incubated with SB431542 (5 µmol/L, Calbiochem) to block both SMAD2 and SMAD3 activation for 1 h before beginning treatment. SB431542 specifically inhibits the activity of ALK4, ALK5, and ALK7, which signal through SMAD2 and SMAD3, without effect on other cellular kinases [33, 34]. SB431542 is also without effect on levels of pSMAD1/5/8 or nonphosphorylated SMAD2 in cumulus cells [35]. In some experiments, POCs were cultured for 2–10 days on collagen membranes in bicarbonate-buffered Waymouth medium MB 752 (Sigma, St. Louis, MO) supplemented with 3 mg/ml BSA, 5 µg/ml insulin, 5 µg/ml transferrin, and 5 ng/ml selenium or medium containing FSH (0.005 IU/ml).

All cultures were maintained at 37°C in a modular incubation chamber (Billups Rothenberg, Del Mar, CA) in an atmosphere of 5% O2, 5% CO2, and 90% N2. Samples taken at various times were frozen in liquid nitrogen and stored at –70°C until analyzed for steady-state mRNA levels as described below. All reagents were purchased from Sigma Chemical Company (St. Louis, MO), unless otherwise noted.

In Situ Hybridization

A fragment of 803 bp from the Pcsk6 gene (EMBL accession number BC037450) was amplified by PCR using gene-specific primers: 5'-ATCCCCATAGTGCAGGTGCTAC-3' and 5'-CTTTCATCAGCATAAAGTCCGG-3'. The PCR product was cloned into pCRII–TOPO plasmid using the TOPO TA Cloning Kit (Invitrogen) and was sequenced to confirm its identity. Plasmid DNA was digested with XhoI (antisense) or SpeI (sense) and used for in vitro transcription to make [33P]-CTP-labeled riboprobes for in situ hybridization as reported previously [36].

Isolation of mRNA and Real-Time RT-PCR

Total RNA was isolated from frozen samples (25 COC, POC, or oocytectomized complexes) and reverse transcribed into cDNA as described previously [37]. Quantification of Pcsk6 mRNA in POC and isolated preantral granulosa cells was conducted using real-time PCR with gene-specific primers (Pcsk6-F, TCCTCGATGACGGCATAGAAA; Pcsk6-R, TTCTCGTTGCTGGCGTCATAT), as described previously [37]. Only one product, which was of the appropriate size, was identified and sequenced to confirm specificity of the PCR reaction. Levels of Rpl19 mRNA was used to normalize specific levels of Pcsk6 mRNA according to the formula 2-(Ct gene of interest - Ct Rpl19), where Ct is the cycle number at which point the fluorescent intensity for each sample crosses a threshold level set above background, as described previously [29, 37]. All experiments were repeated three or four times and values shown are the mean ± SEM.

Immunoblot

Samples were prepared from 40 to 50 POCs or from ovaries from 12-day-old animals. Treatment groups are described in figure legends and in the Results section. Samples were simultaneously denatured by boiling in 1X loading buffer for 5 min, followed by quenching on ice for 5 min. Whole ovaries were homogenized in 1X loading buffer using an electric tissue homogenizer. Proteins were separated on a 10%–15% SDS PAGE gel and transferred to PVDF membrane. Membranes were blocked in 1X blocking buffer (Odyssey Blocking Buffer, Licor Bioscience, Lincoln, NE) for 1 h with shaking at room temperature followed by incubation with specific anti-pSMAD2 antibody (1:1000, Invitrogen), anti-PCSK6 (1:1000, Alexis Biochemicals), or β-actin (ACTB) antibody (1:6000, Sigma) diluted in blocking buffer with 0.1% Tween-20 for 2–12 h at room temperature. Following incubation, blots were subjected to three 10-min washes with wash buffer (PBS, 0.1% Tween-20). Fluorescently labeled secondary antibodies (IRDye 800 anti-mouse or anti-rabbit, Rockland Immunochemicals, Inc., Gilbertsville, PA) were diluted at 1:5000 and incubated with the blots for 1 h at room temperature. Blots were washed as above with an additional final wash in PBS without Tween-20. Detection was accomplished with an infrared scanner (Licor Bioscience).

Immunofluorescence

Ovaries from 12-day-old mice, 20-day-old mice, and 20-day-old mice primed with eCG (44 h) followed by hCG (8 h) were fixed overnight in 4% parformaldehyde and embedded in paraffin wax. Ovarian sections were dewaxed in xylene (two 5-min washes) followed by incubation for 5 min in each of the following: xylene:ETOH (1:1), 100% ETOH (2X), 95% ETOH, 85% ETOH, 75% ETOH, and ddH2O. Slides were then incubated in 1X antigen retrieval solution (DakoCytomation Retrieval solution) at 95°C for 25 min, followed by two 10-min washes with ddH2O and three 5-min washes with PBS. Slides were then incubated in blocking buffer (PBS, pH 7.4, 3% BSA, 10% goat serum, and 0.05% Triton-X 100) for 1 h at room temperature followed by incubation with anti-PCSK6 (1:500, Alexis Biochemicals) diluted in blocking buffer for 12 h at 4°C. Slides were then subjected to three 15-min washes with wash buffer (PBS 0.1% Triton-X 100), followed by incubation with Goat anti-rabbit IgG Alexa-594 conjugate (1:1500, Molecular Probes) for 1 h at room temperature, after which they were counterstained with DAPI and mounted with anti-fade solution (Slow-fade, Molecular Probes). Slides were imaged using in an Olympus BX60 upright fluorescent microscope connected to a 3CCD camera and computer.

Statistical Analyses

Results from mRNA expression experiments were analyzed by either two-way ANOVA within-treatment group followed by Tukeys HSD post-hoc test if a positive F-test was detected or by Student t-test as indicated in the figure legends. A P-value less than or equal to 0.05 was considered statistically significant. Microsoft Excel was used for Student t-test analysis and JMP 6.1 statistical analysis software was used for ANOVA analyses (SAS, Cary, NC).

RESULTS

Expression Pattern of Pcsk6 mRNA and Protein

In situ hybridization of ovarian tissue sections revealed that Pcsk6 mRNA was expressed by granulosa cells of small to medium preantral follicles regardless of age of the animal (Day 12 or 20) (Fig. 1, A-C), but not in antral follicles (Fig. 1C). The staining pattern of PCSK6 protein was very similar to that of the mRNA with high levels in preantral granulosa cells and lower staining in antral follicles (Fig 2, A, C-D). Specific-staining was determined by omiting primary antibody (Fig. 2B). Only one immunoreactive band of approximately 65 kDa was detected in whole ovary lysates from 12-day-old animals (Fig. 2E). This size protein probably represents an alternatively spliced isoform of PCSK6 [38, 39]. Levels of PCSK6 protein were not induced in preovulatory follicles of hCG-treated animals (Fig. 2D).


Figure 01
View larger version (101K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 1 In situ hybridization of Pcsk6 mRNA in ovaries collected from animals on postnatal Day 12 (A, B), and Day 22 ovary primed with eCG (48 h) (C). Arrows indicate staining in the theca cell layer of antral follicles. Panels A and C were hybridized with anti-sense probe to Pcsk6 mRNA and panel B was hybridized with the corresponding Pcsk6 sense probe. D) Schematic representation of Pcsk6 mRNA localization (green) in primary (1), secondary (2), large secondary (3), and antral (4) follicles. Original magnification A, B x100; C x40.


Figure 02
View larger version (82K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 2 Immunostaining for PCSK6 protein in ovarian follicles. A) Granulosa cells of Day 12 ovaries stain strongly for PCSK6. B) No staining was observed when the primary antibody was omitted. C) Preantral granulosa cells stain more strongly than mural or cumulus cells in Day 20 ovaries. Arrowhead: preantral follicle; arrow: antral follicle. D) Staining of PCSK6 protein was not affected by eCG (48 h) followed by hCG (8 h) treatment. E) Immunoblot of whole ovarian lysates from 12-day-old animals (n = 4) using anti-PCSK6 antibody detected a single band of approximately 65 kDa. Original magnification A, C, and D x100; B x200.

Regulation of Steady-State Pcsk6 mRNA Levels by Fully Grown, but Not Growing, Oocytes

Real-time PCR analysis revealed that POCs expressed much higher levels of Pcsk6 mRNA than either COCs or mural granulosa cells from antral follicles (Fig. 3A). The levels of some transcripts observed in granulosa cells are elevated by oocyte-derived paracrine factors (e.g., Slc38a3, Ldha, Pfkp, Amh, Ptgs2, Has2, Ptx3, and Tnfaip6) [1, 2, 5, 30, 35, 37, 40]. To determine whether growing oocytes from preantral follicles affect levels of Pcsk6, intact POCs or OOX POCs (preantral granulosa cells or PAGCs) were cultured for 15 h. Intact POCs expressed high levels of Pcsk6 but, surprisingly, OOX did not affect Pcsk6 mRNA levels, indicating that growing oocytes are not acutely (within 15 h) required for maintaining steady-state levels of this transcript (Fig. 3B). However, since COCs express much lower levels of Pcsk6 mRNA than POCs (Fig. 3A), the effect of coculture of POCs with fully grown oocytes from antral follicles was measured in an oocyte-granulosa cell stage-mismatch experiment. Fully grown oocytes potently suppressed levels of Pcsk6 mRNA in preantral granulosa cells to levels similar to those found in COCs (Fig. 3C).


Figure 03
View larger version (9K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 3 A) Expression of Pcsk6 mRNA in preantral granulosa cell-oocyte complexes (POCs) from preantral follicles and in cumulus-oocyte complexes (COCs) and mural granulosa cells from antral follicles. B) Effect of oocytectomy on levels of Pcsk6 mRNA in preantral-oocyte complexes (POCs) and oocytectomized POCs (PAGC) cultured for 15 h. C) Levels of Pcsk6 mRNA in POCs cultured with or without fully grown oocytes for 15 h and in COCs from antral follicles. Levels of Pcsk6 mRNA were normalized to Rpl19 mRNA. abc Values with different letters are significantly different, P < 0.05.

Previous studies revealed that oocyte-derived paracrine factors affect the levels of various transcripts via SMAD2 phosphorylation [35]. To determine whether fully grown oocytes suppress Pcsk6 mRNA levels in preantral granulosa cells using SMAD2-mediated pathways, POCs were cultured in control medium, cocultured with fully grown oocytes, cultured in the presence of an inhibitor of SMAD2/3 activation (SB431542), or both fully grown oocytes and SB431542 for 15 h. Phosphorylation (activation) of SMAD2 was also measured in these samples. POCs cultured in control medium expressed high levels of Pcsk6 mRNA and relatively low levels of pSMAD2, but coculture with fully grown oocytes suppressed Pcsk6 mRNA levels (Fig. 4A) and was associated with an increase in pSMAD2 levels (Fig. 4B). SB431542 treatment alone had no effect on Pcsk6 mRNA, but partially blocked the suppressive effect of fully grown oocytes on Pcsk6 mRNA levels (Fig. 4A).


Figure 04
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 4 Effect of SB431542 and coculture with fully grown oocyte on Pcsk6 mRNA (A) and pSMAD2 levels (B) in complexes from preantral follicles. Preantral complexes were cultured with or without fully grown oocytes (FGO) (2 oocytes/ml), SB431542 (10 µmol/L), or both FGO and SB431542 for 15 h and then analyzed for Pcsk6 mRNA, pSMAD2, and ACTB (beta-actin) levels. abc Values with different letters are significantly different, P < 0.05.

Effect of FSH on Pcsk6 mRNA Levels

FSH promotes the preantral to antral follicle transition [41, 42]. Therefore, the effect of FSH on Pcsk6 mRNA levels in granulosa cells was determined. FSH treatment increased Pcsk6 mRNA levels in POCs cultured for 15 h (Fig. 5A). However, FSH did not overcome the suppressive effect of fully grown oocytes on Pcsk6 mRNA levels (Fig. 5A). Next, the effect of FSH on Pcsk6 mRNA levels in isolated cumulus or mural granulosa cells was tested. FSH had a weak stimulatory effect on Pcsk6 mRNA levels in both mural and cumulus cells. This was suppressed by the fully grown oocytes, and this suppressive effect was antagonized by SB431542 (inhibiting SMAD2 phosphorylation) treatment (Fig. 5, B-C).


Figure 05
View larger version (8K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 5 A) Effect of fully grown oocytes (FGO) and/or FSH on expression of Pcsk6 mRNA in preantral granulosa cell-oocyte complexes (POCs) cultured alone, with fully grown oocytes (2 oocytes/ml), FSH (0.5 IU/ml), or fully grown oocytes plus FSH for 15 h. Expression of Pcsk6 mRNA in cumulus cells (B) or mural cells (C) cultured alone, with FSH (0.5 IU/ml), FSH and FGOs (2/µl), or FSH/FGOs and SB431542 (10 µmol/L) for 15 h. abc Values with different letters are significantly different, P < 0.05.

Suppression of Pcsk6 mRNA During Preantral to Antral Transition

POCs from 12-day-old pups can be cultured for periods up to about 10 days on collagen-coated membranes to allow development of COCs [4, 29, 43]. Since elevated Pcsk6 mRNA was found only in preantral granulosa cells, POCs were cultured on collagen-coated membranes to determine whether the in vivo pattern of expression is recapitulated in vitro, and to test the effect of low levels of FSH (0.005 IU/ml) on Pcsk6 mRNA levels during the period coincident with the preantral to antral transition [29, 37]. Levels of Pcsk6 mRNA were significantly decreased in granulosa cells by 6 days of culture regardless of whether FSH was present (Fig. 6A). To determine when oocytes acquire the ability to suppress levels of Pcsk6 mRNA, oocytectomized POCs from 12-day-old mice were cocultured with denuded oocytes collected from neonatal mice on Days 12 (4 oocytes/µl), 14 (3 oocytes/µl), 16 (3 oocytes/µl), and 18 (2 oocytes/µl); oocytes obtained from ovaries of mice of these ages correspond with oocytes taken from medium preantral, large preantral, early antral, and large antral follicles respectively. As shown in Figure 6B, as oocytes were isolated during the preantral to antral follicle transition in vivo, they progressively acquired competence to suppress the levels of Pcsk6 mRNA in preantral granulosa cells.


Figure 06
View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 6 (A) Levels of Pcsk6 mRNA in preantral-oocyte complexes cultured in vitro on collagen membranes for 2–10 days in control medium or medium with FSH (0.005 IU/ml). *Indicates values different than samples collected on Day 2 for both control and FSH-treated complexes, P < 0.05. (B) Levels of Pcsk6 mRNA in preantral granulosa cells from 12-day-old mice cocultured for 15 h with denuded oocytes collected on postnatal Days 12, 14, 16, and 18. abc Values with different letters are significantly different, P < 0.05.

DISCUSSION

This study examined the regulation of Pcsk6 mRNA, which encodes a proprotein convertase present in the ovary, during the progression of follicular development in the mouse. Pcsk6 mRNA and protein were expressed robustly in granulosa cells of preantral follicles, but at much lower levels in cumulus cells and mural granulosa cells of antral follicles. Pcsk6 mRNA levels were not affected by growing oocytes from preantral follicles, but were potently suppressed by paracrine factor(s) secreted by fully grown oocytes from antral follicles. These factors act in part by stimulating SMAD2/3-mediated pathways in granulosa cells. Pcsk6 mRNA levels in granulosa cells were suppressed by oocytes as they developed during the preantral to antral follicle transition. FSH stimulated elevation of Pcsk6 mRNA levels in POCs, but did not block the ability of fully grown oocytes to suppress Pcsk6 mRNA levels. Granulosa cells lost the ability to respond to FSH by robustly increasing Pcsk6 mRNA once they differentiated to either cumulus or mural granulosa cells of antral follicles, suggesting that this aspect of the transition of preantral granulosa cells to cumulus/mural granulosa cells is irreversible.

FSH is essential for the development of large preantral and antral follicles, as deletion of Fshb or its receptor, Fshr, leads to follicular development arrested at the late preantral or early antral stages [41, 42]. FSH also stimulates levels of mural marker transcripts in mural granulosa cells [35, 40]. The effect of FSH on preantral granulosa cells is not well characterized. Results presented here show that preantral granulosa cells are clearly responsive to FSH for the elevation of Pcsk6 mRNA levels in vitro. However, levels of this transcript are much lower in antral follicles. That neither oocytectomy of COCs and/or stimulation with FSH elevate levels of Pcsk6 mRNA in cumulus cells (or mural cells) demonstrates that the capacity of these cell types to upregulate Pcsk6 is irrevocably altered during differentiation. Thus, low levels or Pcsk6 mRNA in mural and cumulus cells may be due to permanent alterations in the granulosa cells that render them incapable of responding to FSH by increased levels of Pcsk6 mRNA. In contrast, Lhcgr mRNA levels increase significantly in cumulus cells after removal of oocytes and stimulation with FSH [35, 40]. Thus, although some cumulus cells can change to express mural-like characteristics depending upon stimulation with FSH and/or oocyte-derived paracrine factors, cumulus cell differentiation from preantral granulosa cells appears irreversible.

Granulosa cells of various types express many transcripts in common. Preantral granulosa cells give rise to both cumulus and mural granulosa cells of antral follicles, but the preantral granulosa cells are more similar to cumulus cells than to mural granulosa cells. Both cumulus cells and preantral granulosa cells, but not mural cells, label strongly for a surface antigen (OA-1) [44], express anti-mullerian hormone (AMH) [45, 46], and the amino acid transporter SLC38A3 [5]. However, preantral granulosa cells are not functionally the same as cumulus cells since they are unable to undergo cumulus expansion, even when provided with appropriate stimuli [37]. Additional changes induced by oocytes occur in the preantral cells as they differentiate into cumulus cells [29, 37]. Several transcripts—such as Amh, Slc38a3, and Ar—are expressed more highly in cumulus cells, as compared to mural cells. These transcripts are also expressed at high levels in late preantral granulosa cells, and this level is sustained in cumulus cells, but not mural cells, by oocyte-secreted factors [5, 35, 46]. In contrast, levels of other transcripts, such as Ldha and Pfkp, encoding glycolytic enzymes, are promoted by oocytes only after antrum formation [2, 47].

Unlike transcripts that are expressed highly in cumulus cells and preantral granulosa cells, the expression pattern and regulation of Pcsk6 mRNA is unique in that it is highly expressed in preantral granulosa cells, but at barely detectable levels in cumulus cells or mural granulosa cells. Although this is the first transcript identified that displays this unique expression pattern, undoubtedly there are others, as preantral granulosa cells express many unique protein products, as examined by 2-D gel electrophoresis [48]. During differentiation of preantral granulosa cells into cumulus cells, oocyte-derived paracrine factors stimulate expression of transcripts important for cumulus cell function [29, 35, 37]. In the present study, oocytes progressively acquire the ability to suppress levels of Pcsk6 mRNA during the establishment of the cumulus cell phenotype. This occurs during both in vivo and in vitro differentiation of COCs and presents the first example of suppression of mRNA levels by oocytes during the preantral to antral follicle transition. In previous studies, the inhibitory effect of oocytes on mRNA levels were limited to suppression of mural marker transcripts, such as Lhcgr, Cyp11a1 and Cd34, which are induced by FSH in mural, but not cumulus cells [35, 40].

Oocytes drive differentiation of preantral granulosa cells to cumulus cells. Preantral granulosa cells differentiate into cumulus cells with the ability to undergo expansion in vitro, but only if cocultured with fully grown oocytes [29]. Moreover, oocytes promote the differentiation and maintenance of the cumulus cell phenotype, and prevent expression of the mural granulosa cell phenotype [2, 5, 29, 35, 36]. Thus, oocytes initiate a developmental program in preantral granulosa cells that leads to differentiation into cumulus cells during the preantral to antral follicle transition. Therefore, oocyte-derived paracrine factors could either specifically suppress Pcsk6 mRNA expression or initiate a general program driving the preantral granulosa cell to cumulus cell transition that includes downstream suppression of Pcsk6 transcript levels.

Fully grown oocytes suppress levels of mural transcripts via a pSMAD2/3-mediated mechanism [35, 40]. Likewise, in POCs, an inhibitor of SMAD2/3 activation partially blocks the ability of fully grown oocytes to suppress Pcsk6 mRNA levels. Thus, oocytes use similar SMAD2/3-dependent mechanisms to suppress both mural transcripts and preantral Pcsk6 transcripts in developing cumulus cells. However, pSMAD2 activation alone is insufficient to suppress Pcsk6 mRNA since the inhibitor of pSMAD2 activation (SB431542) does not fully block the oocyte's suppressive effect. Furthermore preantral follicles stain strongly for pSMAD2 [35, 40] and yet express high levels of Pcsk6 mRNA. Thus, suppression of Pcsk6 requires additional pathways to be activated by oocytes. Importantly, strong activation of pSMAD2 in preantral granulosa cells indicates that TGFβ ligands are present in preantral follicles and are likely processed by PCSK6.

The physiological implications of the decrease in Pcsk6 mRNA levels during the preantral to antral transition remain to be defined. The present study does not address the functional role of Pcsk6 in preantral granulosa cells or why this transcript should be downregulated in antral follicles. One clue to the function of Pcsk6 comes from animals with a deletion of the Pcsk6 gene, which leads to severe embryonic patterning defects and embryonic lethality in a high proportion of homozygous mutant embryos [24]. These defects resemble those found in Bmp4 mutant embryos [49], underscoring the importance of PCSK6 in processing BMP4 to its biologically active form. Some Pcsk6 mutant embryos survive and produce offspring, but it is unclear if their fertility is normal [24]. However, the experiments presented here identified Pcsk6 as a preantral granulosa cell-specific transcript that is stimulated by FSH, but progressively suppressed by oocyte-secreted factors during antrum formation. Differentiated granulosa cells are unable to upregulate Pcsk6 mRNA once suppressed. We may speculate on the functional role of Pcsk6 and the importance of its downregulation during antrum formation. One attractive possibility is that the cocktail of TGFβ ligands differs in preantral versus antral follicles as a consequence of Pcsk6 action. Similar ligands may be processed differently in a microenvironment containing PCSK6 versus one devoid of this protein, or some ligands may be processed more efficiently by PCSK6. In particular, two TGFβ superfamily members, GDF9 and AMH, exert their biological effect during the same developmental period when PCSK6 is most highly produced. Gdf9-null follicles arrest at the primary stage [50, 51], while Amh-null mice exhibit increased follicular activation [12, 52]. Both GDF9 and AMH are highly expressed in preantral follicles [12, 50–52] and may be targets of PCSK6. Another possibility is that PCSK6 is involved in the processing of ZP proteins during formation of the zona pellucida, which is produced by oocytes mostly during preantral follicular development [53]. Thus, Pcsk6 represents another granulosa cell transcript regulated by oocytes, but exhibiting a novel expression pattern during follicular development. Future studies will focus on potential targets of PCSK6 activity and on the activity and regulation of other convertase proteins present in the ovary.

ACKNOWLEDGMENTS

We thank Drs. Mary Ann Handel and Ann Dorward for their helpful suggestions in the preparation of this manuscript.

FOOTNOTES

1This work was supported by NIH HD23839. Back

Correspondence: 2John J. Eppig, The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609. FAX: 207 288 6073; e-mail: john.eppig{at}jax.org

Received: 18 June 2007.

First decision: 15 July 2007.

Accepted: 28 September 2007.

REFERENCES

  1. Eppig JJ. Oocyte control of ovarian follicular development and function in mammals Reproduction 2001 122829–838[Abstract]
  2. Sugiura K, Pendola FL, Eppig JJ. Oocyte control of metabolic cooperativity between oocytes and companion granulosa cells: energy metabolism Dev Biol 2005 27920–30[CrossRef][Medline]
  3. Gilchrist RB, Ritter LJ, Myllymaa S, Kaivo-Oja N, Dragovic RA, Hickey TE, Ritvos O, Mottershead DG. Molecular basis of oocyte-paracrine signalling that promotes granulosa cell proliferation J Cell Sci 2006 1193811–3821[Abstract/Free Full Text]
  4. Vanderhyden BC, Telfer EE, Eppig JJ. Mouse oocytes promote proliferation of granulosa cells from preantral and antral follicles in vitro Biol Reprod 1992 461196–1204[Abstract]
  5. Eppig JJ, Pendola FL, Wigglesworth K, Pendola JK. Mouse oocytes regulate metabolic cooperativity between granulosa cells and oocytes: amino acid transport Biol Reprod 2005 73351–357[Abstract/Free Full Text]
  6. Hussein TS, Froiland DA, Amato F, Thompson JG, Gilchrist RB. Oocytes prevent cumulus cell apoptosis by maintaining a morphogenic paracrine gradient of bone morphogenetic proteins J Cell Sci 2005 1185257–5268[Abstract/Free Full Text]
  7. Kaivo-oja N, Jeffery LA, Ritvos O, Mottershead DG. Smad signalling in the ovary Reprod Biol Endocrinol 2006 421[CrossRef][Medline]
  8. Knight PG and Glister C. TGF-β superfamily members and ovarian follicle development Reproduction 2006 132191–206[Abstract/Free Full Text]
  9. Matzuk MM and Lamb DJ. Genetic dissection of mammalian fertility pathways Nature Medicine 2002 841–49[CrossRef][Medline]
  10. Shimasaki S, Moore RK, Erickson GF, Otsuka F. The role of bone morphogenetic proteins in ovarian function Reproduction Suppl 2003 61323–337
  11. Drummond AE. TGFβ signalling in the development of ovarian function Cell Tissue Res 2005 322107–115[CrossRef][Medline]
  12. Visser JA, Durlinger ALL, Peters IJJ, van den Heuvel ER, Rose UM, Kramer P, de Jong FJ, Themmen APN. Increased oocyte degeneration and follicular atresia during the estrous cycle in AMH null mice Endocrinology 2007 1482301–2308[Abstract/Free Full Text]
  13. Durlinger ALL, Gruijters MJG, Kramer P, Karels B, Kumar TR, Matzuk MM, Rose UM, de Jong FH, Uilenbroek JTJ, Grootegoed JA, Themmen APN. Anti-Mullerian hormone attenuates the effects of FSH on follicle development in the mouse ovary Endocrinology 2001 1424891–4899[Abstract/Free Full Text]
  14. Chang H, Brown CW, Matzuk MM. Genetic analysis of the mammalian transforming growth factor-beta superfamily Endocr Rev 2002 23787–823[Abstract/Free Full Text]
  15. Liu K. Stem cell factor (SCF)-kit mediated phosphatidylinositol 3 (PI3) kinase signaling during mammalian oocyte growth and early follicular development Front Biosci 2006 11126–135[Medline]
  16. Liu K, Rajareddy S, Liu L, Jagarlamudi K, Boman K, Selstam G, Reddy P. Control of mammalian oocyte growth and early follicular development by the oocyte PI3 kinase pathway: New roles for an old timer Dev Biol 2006 2991–11[CrossRef][Medline]
  17. Scamuffa N, Calvo F, Chrétien M, Seidah NG, Khatib A-M. Proprotein convertases: lessons from knockouts FASEB J 2006 201954–1963[Abstract/Free Full Text]
  18. Feng Y, Reznik SE, Fricker LD. ProSAAS and prohormone convertase 1 are broadly expressed during mouse development Brain Res Gene Expr Patterns 2002 1135–140[CrossRef][Medline]
  19. Marcinkiewicz M, Ramla D, Seidah N, Chrétien M. Developmental expression of the prohormone convertases PC1 and PC2 in mouse pancreatic islets Endocrinology 1994 1351651–1660[Abstract]
  20. Tadros H, Chrétien M, Mbikay M. The testicular germ-cell protease PC4 is also expressed in macrophage-like cells of the ovary J Reprod Immunol 2001 49133–152[CrossRef][Medline]
  21. Mbikay M, Tadros H, Ishida N, Lerner CP, Lamirande ED, Chen A, El-Alfy M, Clermont Y, Seidah NG, Chrétien M, Gagnon C, Simpson EM. Impaired fertility in mice deficient for the testicular germ-cell protease PC4 Proc Natl Acad Sci U S A 1997 946842–6846[Abstract/Free Full Text]
  22. Constam D, Calfon M, Robertson E. SPC4, SPC6, and the novel protease SPC7 are coexpressed with bone morphogenetic proteins at distinct sites during embryogenesis J Cell Biol 1996 134181–191[Abstract/Free Full Text]
  23. Lusson J, Vieau D, Hamelin J, Day R, Chrétien M, Seidah NG. cDNA structure of the mouse and rat subtilisin/kexin-like PC5: a candidate proprotein convertase expressed in endocrine and nonendocrine cells Proc Natl Acad Sci U S A 1993 906691–6695[Abstract/Free Full Text]
  24. Constam DB and Robertson EJ. SPC4/PACE4 regulates a TGFbeta signaling network during axis formation Genes Dev 2000 141146–1155[Abstract/Free Full Text]
  25. Constam DB and Robertson EJ. Regulation of Bone Morphogenetic Protein Activity by Pro Domains and Proprotein Convertases J Cell Biol 1999 144139–149[Abstract/Free Full Text]
  26. Essalmani R, Hamelin J, Marcinkiewicz J, Chamberland A, Mbikay M, Chrétien M, Seidah N, Prat A. Deletion of the Gene Encoding Proprotein Convertase 5/6 Causes Early Embryonic Lethality in the Mouse Mol Cell Biol 2006 26354–361[Abstract/Free Full Text]
  27. Nachtigal MW and Ingraham HA. Bioactivation of Müllerian inhibiting substance during gonadal development by a kex2/subtilisin-like endoprotease Proc Natl Acad Sci USA 1996 937711–7716[Abstract/Free Full Text]
  28. Buccione R, Vanderhyden BC, Caron PJ, Eppig JJ. FSH-induced expansion of the mouse cumulus oophorus in vitro is dependent upon a specific factor(s) secreted by the oocyte Dev Biol 1990 13816–25[CrossRef][Medline]
  29. Diaz FJ, Wigglesworth K, Eppig JJ. Oocytes are required for the preantral granulosa cell to cumulus cell transition in mice Dev Biol 2007 305300–311[CrossRef][Medline]
  30. Joyce IM, Pendola FL, Wigglesworth K, Eppig JJ. Oocyte regulation of kit ligand expression in mouse ovarian follicles Dev Biol 1999 214342–353[CrossRef][Medline]
  31. Vanderhyden BC, Caron PJ, Buccione R, Eppig JJ. Developmental pattern of the secretion of cumulus-expansion enabling factor by mouse oocytes and the role of oocytes in promoting granulosa cell differentiation Dev Biol 1990 140307–317[CrossRef][Medline]
  32. Chesnel F and Eppig JJ. Synthesis and accumulation of p34cdc2 and cyclin B in mouse oocytes during acquisition of competence to resume meiosis Mol Reprod Dev 1995 40503–508[CrossRef][Medline]
  33. Inman GJ, Nicolás FJ, Callahan JF, Harling JD, Gaster LM, Reith AD, Laping NJ, Hill CS. SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7 Mol Pharmacol 2002 6265–74[Abstract/Free Full Text]
  34. Laping NJ, Grygielko E, Mathur A, Butter S, Bomberger J, Tweed C, Martin W, Fornwald J, Lehr R, Harling J, Gaster L, Callahan JF, Olson BA. Inhibition of transforming growth factor (TGF)-beta1-induced extracellular matrix with a novel inhibitor of the TGF-beta type I receptor kinase activity: SB-431542 Mol Pharmacol 2002 6258–64[Abstract/Free Full Text]
  35. Diaz FJ, Wigglesworth K, Eppig JJ. Oocytes determine cumulus cell lineage in mouse ovarian follicles J Cell Sci 2007 1201330–1340[Abstract/Free Full Text]
  36. Sugiura K, Su YQ, Diaz FJ, Pangas SA, Sharma S, Wigglesworth K, O'Brien MJ, Matzuk MM, Shimasaki S, Eppig JJ. Oocyte-derived BMP15 and FGFs cooperate to promote glycolysis in companion cumulus cells Development 2007 1342593–2603[Abstract/Free Full Text]
  37. Diaz FJ, O'Brien MJ, Wigglesworth K, Eppig JJ. The preantral granulosa cell to cumulus cell transition in the mouse ovary: development of competence to undergo expansion Dev Biol 2006 29991–104[CrossRef][Medline]
  38. Tsuji A, Mori K, Hine C, Tamai Y, Nagamune H, Matsuda Y. The tissue distribution of mRNAs for the PACE4 isoforms, kexin-like processing protease: PACE4C and PACE4D mRNAs are major transcripts among PACE4 isoforms Biochem Biophys Res Commun 1994 2021215–1221[CrossRef][Medline]
  39. Tsuji A, Higashine K, Hine C, Mori K, Tamai Y, Nagamune H, Matsuda Y. Identification of novel cDNAs encoding human kexin-like protease, PACE4 isoforms Biochem Biophys Res Commun 1994 200943–950[CrossRef][Medline]
  40. Eppig JJ, Pendola FL, Wigglesworth K. Mouse oocytes suppress cAMP-induced expression of LH receptor messenger RNA by granulosa cells in vitro Mol Reprod Dev 1998 49327–332[CrossRef][Medline]
  41. Kumar TR, Wang Y, Lu NF, Matzuk MM. Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility Nat Genet 1997 15201–204[CrossRef][Medline]
  42. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, LeMeur M, SassoneCorsi P. Impairing follicle-stimulating hormone (FSH) signaling in vivo: Targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance Proc Natl Acad Sci USA 1998 9513612–13617[Abstract/Free Full Text]
  43. Eppig JJ, O'Brien MJ, Pendola FL, Watanabe S. Factors affecting the developmental competence of mouse oocytes grown in vitro: follicle-stimulating hormone and insulin Biol Reprod 1998 591445–1453[Abstract/Free Full Text]
  44. Erickson GF, Hofeditz C, Unger M, Allen WR, Dulbecco R. A monoclonal antibody to a mammary cell line recognizes two distinct subtypes of ovarian granulosa cells Endocrinology 1985 1171490–1499[Abstract/Free Full Text]
  45. Baarends WM, Uilenbroek JTJ, Kramer P, Hoogerbrugge JW, Van Leeuwen ECM, Themmen APN, Grootegoed JA. Anti-Mullerian hormone and anti-Mullerian hormone type II receptor messenger ribonucleic acid expression in rat ovaries during postnatal development, the estrous cycle, and gonadotropin-induced follicle growth Endocrinology 1995 1364951–4962[Abstract]
  46. Salmon NA, Handyside AH, Joyce IM. Oocyte regulation of anti-Mullerian hormone expression in granulosa cells during ovarian follicle development in mice Dev Biol 2004 266201–208[CrossRef][Medline]
  47. Sugiura K and Eppig JJ. Control of metabolic cooperativity between oocytes and their companion granulosa cells by mouse oocytes Reprod Fertil Dev 2005 17667–674[CrossRef][Medline]
  48. Latham KE, Wigglesworth K, McMenamin M, Eppig JJ. Stage-dependent effects of oocytes and growth differentiation factor 9 on mouse granulosa cell development: advance programming and subsequent control of the transition from preantral secondary follicles to early antral tertiary follicles Biol Reprod 2004 701253–1262[Abstract/Free Full Text]
  49. Winnier G, Blessing M, Labosky P, Hogan B. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse Genes Dev 1995 92105–2116[Abstract/Free Full Text]
  50. Carabatsos MJ, Elvin J, Matzuk MM, Albertini DF. Characterization of oocyte and follicle development in growth differentiation factor-9-deficient mice Dev Biol 1998 204373–384[CrossRef][Medline]
  51. Elvin JA, Clark AT, Wang P, Wolfman NM, Matzuk MM. Paracrine actions of growth differentiation factor-9 in the mammalian ovary Mol Endocrinol 1999 131035–1048[Abstract/Free Full Text]
  52. Durlinger ALL, Gruijters MJG, Kramer P, Karels B, Ingraham HA, Nachtigal MW, Uilenbroek JTJ, Grootegoed JA, Themmen APN. Anti-Mullerian hormone inhibits initiation of primordial follicle growth in the mouse ovary Endocrinology 2002 1431076–1084[Abstract/Free Full Text]
  53. Litscher ES, Qi H, Wassarman PM. Mouse zona pellucida glycoproteins mZP2 and mZP3 undergo carboxy-terminal proteolytic processing in growing oocytes Biochemistry 1999 3812280–12287[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/1/176    most recent
biolreprod.107.063537v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Diaz, F. J
Right arrow Articles by Eppig, J. J
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Diaz, F. J
Right arrow Articles by Eppig, J. J
Agricola
Right arrow Articles by Diaz, F. J
Right arrow Articles by Eppig, J. J

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS