|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gamete Biology; |
Department of Molecular and Cellular Physiology,5 University of Massachusetts Medical School, Worcester, Massachusetts 01655
Department of Cell and Developmental Biology and Anatomy,6 University of South Carolina School of Medicine, Columbia, South Carolina 29208
ABSTRACT
A hallmark of male germ cell gene expression is the generation by alternative polyadenylation of cell-specific mRNAs, many of which utilize noncanonical A(A/U)UAAA-independent polyadenylation signals. Cleavage factor I (CFIm), a component of the pre-mRNA cleavage and polyadenylation protein complex, can direct A(A/U)UAAA-independent polyadenylation site selection of somatic cell mRNAs. Here we report that the CFIm subunits NUDT21/CPSF5 and CPSF6 are highly enriched in mouse male germ cells relative to somatic cells. Both subunits are expressed from spermatogenic cell mRNAs that are shorter than the corresponding somatic transcripts. Complementary DNA sequencing and Northern blotting revealed that the shorter Nudt21 and Cpsf6 mRNAs are generated by alternative polyadenylation in male germ cells using proximal poly(A) signals. Both sets of transcripts contain CFIm binding sites within their 3'-untranslated regions, suggesting autoregulation of CFIm subunit formation in male germ cells. CFIm subunit mRNA and protein levels exhibit distinct developmental variation during spermatogenesis, indicating stage-dependent translational and/or posttranslational regulation. CFIm binding sites were identified near the 3' ends of numerous male germ cell transcripts utilizing A(A/U)UAAA-independent sites. Together these findings suggest that CFIm complexes participate in alternative polyadenylation directed by noncanonical poly(A) signals during spermatogenesis.
alternative polyadenylation, CFIm, gamete biology, gene regulation, spermatogenesis, testis
Spermatogenesis is a dynamic cell-differentiation process that produces a morphologically distinct haploid sperm cell. Although supported by the Sertoli cell in the seminiferous tubule, male gamete development is driven to a great degree by an intrinsic germ cell gene regulatory program that is characterized by the expression of cell-specific transcripts that are developmentally controlled and stage specific [1].
A central feature of male germ cell gene expression is the generation of cell-specific mRNAs by alternative polyadenylation, many of which use noncanonical, A(A/U)UAAA-independent polyadenylation signals [2]. Alternative 3'-end formation controls cell-specific and developmental expression of numerous male germ cell-enriched mRNAs, including those for the transcription factors SREBF2_V1 (SREBP2GC) [3], CREM
[4], and NR6A1 (GCNF) [5]. Spermatogenic cells appear to use alternative polyadenylation more than do somatic cells, and this happens through the selection of noncanonical, A(A/U)UAAA-independent polyadenylation signals in the 3'-untranslated region (UTR) [6, 7]. Further, an increased proportion of male germ cell transcripts have truncated 3'UTRs compared to somatic cell transcripts [8], indicating the preferential use of more proximal polyadenylation signals in the male germ line. Thus, noncanonical poly(A) site selection appears to be an important regulatory mechanism for male germ cell gene expression and development.
Pre-mRNA cleavage and polyadenylation site selection involves the interaction of the cleavage/polyadenylation complex with multiple cis-acting sequence elements located within the transcribed gene [9] and occurs cotranscriptionally [10]. Most somatic mRNAs utilize a canonical A(A/U)UAAA hexamer polyadenylation signal found upstream of the RNA cleavage site, whereas UG- and U-rich sequences are located downstream [11]. The cleavage/polyadenylation complex consists of cleavage polyadenylation specificity factor (CPSF), cleavage factors Im and IIm (CFIm and CFIIm), cleavage stimulatory factor (CstF), poly (A) polymerase (PAP), and poly (A) binding protein II. The downstream U-rich (and possibly GU-rich) sequences are bound by CstF, which, together with CFIm and CFIIm, is specifically required for the pre-mRNA cleavage step [11]. CPSF binds to the hexamer sequence and interacts directly with PAP, and these two proteins are required for both the cleavage and polyadenylation steps [12].
Additional upstream elements also function as enhancers of 3'-end processing [9] and are evolutionarily conserved [13]. These include "U-rich" sequences as well as UGUAN elements [14]. Several trans-factors are present on upstream U-rich elements as part of a large complex composed of RNA splicing factors and components of the 3'-end processing factors Cstf and CPSF [15]. The CPSF subunit FIP1L1 directly binds to upstream U-rich sites [16]. The UGUA motif can occur upstream as well as downstream of the RNA processing site often as multiple copies, and was identified as a binding site for cleavage factor CFIm using SELEX analysis [17]. GC-rich sequences tend to occur just 3' of the UGUA element, which may contribute to CFIm binding by creating a favorable secondary structure [17].
CFIm facilitates assembly of the 3' processing complex and enhances both the rate and efficiency of poly(A) site cleavage in vitro [18]. This factor binds to pre-mRNA at a very early step and facilitates the binding of other 3'-end processing factors via direct interaction with and recruitment of CPSF, but not CstF or PAP [18, 19]. Multiple UGUAN sites flanking the hexamer site contribute to CFIm binding based on gel shift analysis [14]. Further, these sites promote both pre-mRNA cleavage and poly(A) addition using in vitro reconstitution assays [14, 17]. CFIm is a heterodimer consisting of a 25-kDa protein (NUDT21/CPSF5) and a larger subunit. A complex consisting of NUDT21 and a 68-kDa subunit protein (CPSF6) are sufficient for RNA binding [20], and this heterodimer reconstitutes CFIm processing activity [18]. Additional larger subunits (59 and 72 kDa) also have been identified [18, 19], but their significance remains uncertain.
Several components of the pre-mRNA cleavage/polyadenylation complex are overexpressed or exhibit unique isoforms in the testis or spermatogenic cells relative to their somatic counterparts, including CstF-64 and PAP [21–23]. These unique expression patterns suggested a potential role for these factors in germ cell-specific alternative polyadenylation. However, the machinery responsible for noncanonical poly(A) site selection during spermatogenesis remains uncertain.
Although the majority of somatic transcripts utilize canonical poly(A) sites, noncanonical site utilization also occurs in somatic cells [9]. It was recently found that the CFIm complex composed of NUDT21/CPSF6, in combination with the CPSF subunit FIP1L1 and PAP, is sufficient to direct alternative, A(A/U)UAAA-independent poly(A) site selection and polyadenylation of somatic mRNAs [23]. Further, the CFIm complex is present along the entirety of active transcription units, consistent with a cotranscriptional mechanism of poly(A) site selection [14]. These findings suggested that CFIm is a primary determinant of noncanonical poly(A) site selection. In the present study, we demonstrate that CFIm subunits are expressed at very high levels throughout sperm development from germ cell-enriched, truncated mRNAs formed by alternative polyadenylation. The implications of these results for the regulation of cell-specific polyadenylation during spermatogenesis are discussed.
Testis and somatic tissues were obtained from adult CD-1 male mice (Charles River, Wilmington, MA) following approved guidelines from the University of Massachusetts Institutional Animal Care and Use Committee. Enriched adult spermatogenic cells were prepared by successive protease digestions of decapsulated mouse testes (0.5 mg/ml collagenase and 0.005% trypsin at 33°C) as previously described [3]. Individual mouse spermatogenic stages were purified from adult and immature testes using unit gravity sedimentation on gradients of BSA, as previously described [24, 25].
Total RNA was isolated from mouse tissues and cells using TRI reagent (Sigma, St. Louis, MO) according to the manufacturer's directions. Human tissue total RNAs were purchased from Clontech (Mountain View, CA). The integrity of RNA was visually assessed by the ratio of 28S and 18S ribosomal RNA after ethidium bromide staining of formaldehyde gels and spectrophotometric analysis.
For Northern blot analysis, total RNAs from mouse (20 µg) and human (4 µg) were separated on 10% formaldehyde agarose gels and transferred to Gene Screen Plus membranes (NEN Life Science, Boston, MA). Gene-specific probes were labeled with [
-32P] dCTP by random priming using the Prime-a-Gene Labeling system (Promega, Madison, WI). Membranes were prehybridized at 55°C for 4 h followed by hybridization with labeled probe for 24 h. Prehybridization and hybridization solutions included 5x SSC (0.15 M sodium chloride plus 0.015 M sodium citrate), 50% formamide, 12.5 mM sodium phosphate (pH 6.6), 1% SDS, and 10x Denhardt solution (1% bovine serum albumin, Ficoll 400 [Sigma], 1% polyvinylpyrrolidine [Sigma]. After hybridization, membranes were washed three times at room temperature in 1x SSC, 0.1% SDS then washed three times for 30 min each in 0.1x SSC, 0.1% SDS at 55°C. Bound probe was visualized by autoradiography at –80°C.
Full-length cDNA sequences were generated using a combination of overlapping 3'-RACE and RT-PCR. Complementary DNAs were generated from mouse testis total RNA by RT reaction as previously described [26]. Sequences extending into the 5' and 3'UTRs were generated using gene-specific and nested primers with the Gene Racer kit (Invitrogen, Carlsbad, CA). Refer to Figures 2A and 4A for specific primer sequences used to generate mouse testis sequences for Nudt21 and Cpsf6. Other primer sequences are available upon request. PCR products were gel purified, subcloned into pGEM-T easy vector (Promega, Madison, WI), and sequenced in both directions.
|
|
Proteins were isolated from tissues and cells using whole-cell extraction buffer (20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM EDTA, 10 mM NaF, 25% glycerol, 10 mM dithiothreitol, 1 mM PMSF, 1x protease inhibitor cocktail, and 0.5% NP-40). Nuclear extracts were prepared by high-salt extraction of isolated nuclei [27]. Protein concentration was determined by Coomassie protein assay (Pierce, Woburn, MA). Proteins were separated on 12% SDS-PAGE gels and transferred to Immobilon-P PVDF membranes (Millipore, Billerica, MA). After blocking with 1% nonfat milk for 1 h at room temperature, the blots were incubated with antibody raised against NUDT21/CPSF5 (1:1000; #BC001403; ProteinTech Group, Chicago, IL) or CPSF6 (1:1000; Abnova, Taipei City, Taiwan) overnight at 4°C. The next day, blots were washed three times with PBS-Tween-20 (0.05%) and incubated with respective secondary antibody for 1 h, and bound antibody was visualized with Western Lightning (Perkin Elmer, Wellesley, MA).
Bouin fixed mouse testes were subjected to a deparaffinization, rehydration, and Proteinase K antigen retrieval process. Sections were blocked in 2.5% normal goat serum for 1 h at room temperature followed by three 10-min washes with PBS. Mouse anti-CPSF6 antibody (1:100) was applied to testis tissue sections and incubated overnight at room temperature. Negative control testis sections were incubated in parallel with PBS alone. Sections were then washed three times (10 min each) and then incubated with a goat anti-mouse Cy3 secondary antibody (1:1000) for 1 h at room temperature followed by three additional 10-min washes with PBS. Mounting media was added to the sections prior to visualization under epifluorescence.
Isolated adult mouse germ cells were cross-linked in 1% formaldehyde for 10 min at 37°C. Cross-linking was stopped by adding glycine (125 mM), and the cells were collected and lysed in SDS buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl [pH 8.1], 1mM PMSF and 1x protease inhibitor cocktail mix). Chromatin was sonicated to an average length of
600 bp, and the anti-NUDT21 antibody was added to the lysate. After overnight incubation at 4°C, immune complexes were collected with protein A-agarose (Upstate, Charlottesville, VA). DNA was extracted and used as a template for the PCR assay of genomic sequences contained within the 3'UTRs for mouse Srebf2_v1 (sense, ATGTCTCACCCTCAGAATCTCTCAT; antisense, CCTCTGCCAGGCTGGGTTACAGGCA), Srebf2 encoding the SREBF2 precursor protein (sense, GGTCTCCAGCATGACTTGTTTGC; antisense, CTCTGCTGCCTGCCCTGAAA), Nr6a1 (sense, GAGTGAGCAAAGACACCCTGAT; antisense, CACTCCTTCACCGTACTTGTCTT). Mouse Gabra6 genomic sequences (sense, TTCCAGATTTCCTCACAGCC; antisense, TGCAGATACCCAGCCTCC) were assayed as a negative control.
Abundant Amounts of a Novel Nudt21 Transcript in Mouse Male Germ Cells
Based on recent evidence for the importance of CFIm complexes in noncanonical poly(A) site selection in somatic cells [14], we examined the expression of its subunit genes in mouse testis and male germ cells. Northern blot analysis using a cDNA probe to the coding region of Nudt21 (product A; Fig. 1A) detected an abundant 1.1-kb transcript in mouse testis and enriched adult germ cells that either was not observed or was barely detectable in mouse kidney, liver, brain, and heart (Fig. 1B). This male germ cell-enriched Nudt21 transcript was much shorter than the somatic form amplified from mouse brain (
4.4 kb; GenBank Accession No. BC090834). A larger
4.5-kb transcript was detected in several mouse somatic tissues only after long film exposure (data not shown), indicating that Nudt21 mRNA is preferentially elevated in mouse testis and male germ cells. A faint
2.2-kb band was also variably detected in multiple tissues (Fig. 1B).
|
We used products generated by RT-PCR and 3'-RACE (A–D; Fig. 1A) to determine the nucleotide sequences encompassing the coding region, 3'UTR, and a portion of the 5'UTR of the mouse germ cell Nudt21 RNA. Because the A fragment used as a Northern probe contained both somatic Nudt21 exon 1 and exon 2 sequences, we also probed mouse total RNA with RT-PCR product B, which encompasses only exon 1 (Fig. 1A). This confirmed that the spermatogenic Nudt21 RNA contained somatic exon 1 sequences (Fig. 1C). The overall length of the cDNA (1078 bp) was very similar to that of the male germ cell Nudt21 transcript (1.1 kb; Fig. 2A). The predicted translation product for germ cell NUDT21 is 100% similar to that for mouse brain (Accession No. BC090834) and to a previously reported mouse testis cDNA that lacks a complete 3'UTR sequence (Accession No. AK160147; Fig. 2B). Mouse testis NUDT21 also is highly similar to a predicted human NUDT21 isoform from retina (Accession No. CAD97606) having only a single divergent amino acid residue (hNUDT21–1; Fig. 2B). An alternatively spliced human NUDT21 isoform isolated from skin (Accession No. CAI46057) also has been identified that, except for the final 8 residues, lacks the entire C-terminal half of mouse NUDT21 and human NUDT21–1 (hNUDT21–2; Fig. 2B).
The mouse somatic and germ cell Nudt21 cDNAs differ in the 3'UTR, which is much shorter in the germ cell form (Fig. 1A). This structural difference was confirmed in Northern blots using a probe specific to the somatic Nudt21 3'UTR (probe E; Fig. 1A). The 1.1-kb Nudt21 transcript was not detected in mouse testis, but a less abundant,
4.5-kb transcript was identified in brain and other tissues after a long exposure (Fig. 1D). This larger transcript is highly similar in size to the previously reported mouse brain Nudt21 cDNA (see above). These data suggest that the germ cell-enriched Nudt21 RNA is generated by alternative polyadenylation, although more rapid turnover of the longer transcript form in mouse testis also may contribute to its reduced relative abundance. The usage of testis-specific transcription start sites as well cannot be ruled out.
A Male Germ Cell-Enriched CPSF6 RNA Containing a Truncated 3'UTR
We next examined the transcript abundance for the other CFIm subunit, Cpsf6, in several mouse tissues. 3'-RACE was used to generate a 2-kb fragment (product F; Fig. 3A) for Northern blotting. Similar to Nudt21, RNAs for Cpsf6 were elevated in mouse testis and male germ cells relative to somatic tissues (Fig. 3B). A predominant 2.1-kb RNA was detected in testis and enriched germ cell total RNA (Fig. 3B), with minor species of
4 and 1.5 kb variably detected. The 2.1-kb transcript was shorter than the previously reported Cpsf6 somatic cDNA amplified from brain tissue (
3 kb; GenBank Accession No. BC068133) and mammary tumor (2.5 kb; Accession No. BC031189). Cpsf6 transcripts were generally of low abundance in total RNA of most somatic tissues, with faint bands detected in mouse kidney (
2.5–3 kb) and heart (
1.8 kb). A very weak,
4-kb band was also detected in multiple tissues (Fig. 3B). A 126-bp probe to the first exon of Cpsf6 was generated by RT-PCR of mouse testis total RNA (probe G; Fig. 3A). Northern analysis confirmed that the major 2.1-kb Cpsf6 transcript contained exon 1 sequences (Fig. 3C). Poly(A) mRNA was used for this experiment due to a high level of nonspecific hybridization to ribosomal RNA by this probe.
|
RACE/RT-PCR products F, G, H, and I (Fig. 3A) were characterized to obtain mouse testis Cpsf6 cDNA sequences (Fig. 4A). The overall length of this composite cDNA (2145 kb) was very close to that of the major mouse germ cell-enriched transcript. Comparison of the mouse testis Cpsf6 sequence to several mouse somatic cDNA sequences in Genbank (e.g., Accession Nos. BC068133 and BC031189) confirmed protein sequence identity and apparent lack of alternative splicing (data not shown). As for Nudt21, the mouse germ cell and somatic Cpsf6 cDNAs differed in the length of their 3'UTRs (Fig. 3A). Consistent with this, a probe specific to the 3'UTR of the somatic Cpsf6 transcript (product J; Fig. 3A) did not display detectable hybridization to mouse testis RNA (data not shown).
The mouse testis CPSF6 coding region showed differences with human somatic CPSF6 (Fig. 4B). Two alternatively spliced human kidney Cpsf6 cDNAs have been reported: one possessing additional amino acid residues not in the predicted mouse protein (hCPSF6–1; Accession No. AAH00714) and another (hCPSF6–2; Accession No. AAH05000) that lacks a contiguous stretch of internal residues present in mouse CPSF6 and hCPSF6–1 (Fig. 4B).
Cleavage/Polyadenylation Sequences Within the Germ Cell CFIm Transcripts
The preceding results showed that both Nudt21 and Cpsf6 RNAs in mouse spermatogenic cells were generated by alternative 3'-end formation. Analysis of their 3'UTRs revealed the presence of both canonical and noncanonical polyadenylation sequences upstream of their respective poly(A) addition sites (Figs. 2A and 4A). Further, both 3'UTRs contain CFIm binding sequences (UGUAN) upstream of these sites (Figs. 2A and 4A). This suggested that 3'-end formation for both Nudt21 and Cpsf6 RNAs may be subject to auto-regulation via CFIm complexes in male germ cells.
CFIm Subunit Proteins Are Highly Expressed in Mouse Testis and Spermatogenic Cells
Western blotting was used to determine the expression levels of CFIm proteins in mouse tissues and germ cells. Similar to their transcripts, NUDT21 and CPSF6 proteins were highly elevated in extracts of mouse testis when compared to those of kidney, a representative somatic tissue (Fig. 5A). The apparent sizes of the testis proteins were highly similar to those predicted from the Nudt21 and Cpsf6 testis cDNAs (
25 and 68 kDa, respectively). Further, both CFIm subunits are present in the nuclei of enriched adult mouse germ cells, consistent with a role for CFIm in pre-mRNA cleavage/polyadenylation events in male germ cells (Fig. 5B). Thus, both the mRNAs and proteins for NUDT21 and CPSF6 are highly enriched in mouse spermatogenic cells.
|
CFIm Subunit mRNAs and Proteins Are Differentially Regulated During Spermatogenesis
Northern blot analysis of isolated germ cell populations demonstrated that Nudt21 and Cpsf6 mRNA levels increased during meiotic and spermatid stages of spermatogenesis (Fig. 6A). Both mRNAs were lower in spermatogonia, increased in pachytene spermatocytes, and remained elevated in the round spermatid population. Thus, CFIm subunit gene expression is developmentally up-regulated in meiosis and early haploid stages of spermatogenesis.
|
In contrast to their mRNAs, the levels of CFIm subunit proteins were fairly constant during different stages of spermatogenesis, with no large increases in meiotic cells relative to spermatogonia (Fig. 6B). Thus, CFIm subunit gene and protein expression show discoordinate regulation during mouse spermatogenesis. Immunohistofluorescence further confirmed that CPSF6 protein was present in spermatogonia, spermatocytes, and spermatids, and appeared particularly intense in early elongating spermatids (Stage XI) in fixed mouse testis sections (Fig. 7). CPSF6 antibody staining was not present in later elongating spermatids (Stages VI-VII). Immunostaining with the NUDT21 antibody was non-specific and not informative (data not shown).
|
CFIm Subunit Gene Expression in Human Testis
We also addressed whether Nudt21 and Cpsf6 gene expression is elevated in the human testis. Northern blots for Nudt21 revealed a common
2.2-kb transcript in all human tissues (Fig. 8). However, a Nudt21 mRNA that was similar in size to that for mouse testis (
1.1 kb) was detected within the human testis, although its abundance was not highly elevated relative to the common transcript form, as occurs in the mouse. Cpsf6 transcripts were greatly elevated in human testis relative to somatic tissues. Multiple Cpsf6 RNAs were detected, with major bands of 1.5 and
4 kb and a less abundant
2.1-kb species (Fig. 8). Thus, shorter transcript forms for CFIm subunits also are uniquely generated in human testis.
|
CFIm Binding Sites Are Present Within the 3'UTRs of Numerous Spermatogenic Cell mRNAs
Elevated expression of CFIm subunit proteins in male germ cells suggested their potential involvement in A(A/U)UAAA-independent poly(A) site selection during spermatogenesis. We therefore examined the 3'UTR sequences of numerous male germ cell transcripts harboring noncanonical poly(A) signals for the presence of CFIm binding sites. In all cases, UGUAN sites were identified either upstream or downstream of these signals [28–42] (Table 1). Thus, CFIm binding sites are a common feature of mRNAs undergoing alternative, A(A/U)UAAA-independent polyadenylation during spermatogenesis.
|
We also examined whether CFIm complexes are present on genes that give rise to alternatively polyadenylated mRNAs during spermatogenesis using chromatin immunoprecipitation (ChIP) assays for NUDT21. The mouse Nr6a1 and Srebf2 genes generate predominant, shorter transcripts by alternative polyadenylation during later stages of spermatogenesis [26, 43]. The 3'UTRs for mouse germ cell Nr6a1 and rat and human Srebf2_v1 transcripts contain A(A/U)UAAA-independent poly(A) signals (1), whereas the poly(A) signal for mouse germ cell Srebf2_v1 mRNA is undetermined [3]. ChIP analysis of adult mouse spermatogenic cells using NUDT21 antibodies detected abundant levels of both Nr6a1 and Srebf2 genomic sequences, whereas those for Gabra6, a gene not transcribed in mouse germ cells, were undetectable (Fig. 9A). Thus, CFIm subunits are resident on genes that are alternatively polyadenylated at noncanonical poly(A) sites within spermatogenic cell chromatin.
|
Interestingly, sequences spanning the distal 3'UTR for the Srebf2 mRNA encoding the SREBF2 precursor protein were also abundant in adult mouse germ cell chromatin precipitated by NUDT21 antibody (Fig. 9B). Further, the ratios of the respective proximal Srebf2_v1 and distal Srebf2 3'-UTR genomic sequences were very similar in NUDT21-cross-linked chromatin from mouse germ cells and kidney (Fig. 9B). Previous work has shown that CFIm complexes are present throughout the entirety of a transcribed gene [14], presumably as part of a large transcription/RNA processing complex. NUDT21 ChIP data therefore suggest that elevated accumulation of Srebf2_v1 transcripts in adult male germ cells is due to preferential pre-mRNA processing and/or mRNA stabilization, not enhanced early transcriptional termination. Similar circumstances have been reported for the formation of alternatively polyadenylated mouse Dhfr transcripts [44].
The discovery of a large number of male germ cell-enriched transcripts possessing noncanonical poly(A) signals indicated that A(A/U)UAAA-independent polyadenylation was an important regulatory mechanism during spermatogenesis [2, 21]. In support of this, alternative polyadenylation controls the formation of novel transcription factor isoforms such as Srebf_v1 in male germ cells [3]. The basis for alternative, noncanonical poly(A) site selection remains generally unclear. Recent studies have indicated that CFIm complexes perform an important role in this process in somatic cells. In particular, NUDT21 and CPSF6 protein subunits promote A(A/U)UAAA-independent polyadenylation in conjunction with CPSF [14]. In addition, down-regulation of Nudt21 expression in HeLa cells led to changes in alternative poly(A) site utilization for several somatic mRNAs [45]. As shown here, male germ cells contain elevated amounts of both NUDT21 and CPSF6 proteins, and germ cell-enriched mRNAs utilizing noncanonical poly(A) signals contain consensus CFIm binding sites within their 3'UTRs. This suggests that CFIm may be important for A(A/U)UAAA-independent polyadenylation site selection in male germ cells.
The male germ cell mRNAs for Nudt21 and Cpsf6 are shorter than the previously described somatic isoforms, reflecting the utilization of proximal alternative polyadenylation sites in each case. Sequence analysis did not detect potential canonical or noncanonical polyadenylation signals further upstream of the respective sites for either germ cell mRNA. This suggests that during spermatogenesis, the first suitable polyadenylation signal for these transcripts is utilized. Further, the presence of CFIm consensus binding sites upstream of the Nudt21 and Cpsf6 mRNA poly(A) sites suggests that alternative polyadenylation during spermatogenesis is driven in part by autoregulation of cleavage/polyadenylation factor mRNA 3'-end formation.
Nudt21 and Cpsf6 mRNAs were substantially elevated in meiotic and spermatid stages of spermatogenesis compared to earlier spermatogonial stages, indicating that formation of these transcripts is developmentally regulated during spermatogenesis. In contrast to this, the levels of CFIm subunit proteins remained relatively constant in spermatogonia, pachytene spermatocytes, and round spermatids. Elevated ratios of mRNA to protein abundance in meiotic and postmeiotic spermatogenic cells have been reported for a large number of male germ cell gene products [46], including the transcription factors SP1 and TBP [47, 48]. For CFIm mRNAs, we feel this likely reflects inefficient translation, which is generally observed for mRNAs expressed in later spermatogenic stages [46]. Altered protein turnover may also contribute to discoordinate regulation in these cell types.
The significance of cell-specific alternative polyadenylation for spermatogenesis is not fully understood. Alternative 3'-end formation has been hypothesized to regulate protein coding capacity, localization, translational efficiency, and stability [49]. For example, alternative transcripts can give rise to germ cell-specific proteins having unique structures and apparent functions, as for SREBF2_v1 and CREM
[3, 50]. These regulatory mechanisms may also provide a means for controlling the expression of specific genes in unique cell- or stage-dependent patterns [51].
As for Nudt21 and Cpsf6 mRNAs, alternative polyadenylation in male germ cells tends to give rise to smaller transcripts with shortened 3'UTRs via usage of proximal, frequently noncanonical poly(A) signals [8]. Sequences within 3'UTRs have been implicated in the regulation of both mRNA turnover [52–54] and translation [55] in spermatogenic cells. Messenger RNAs bearing short 3'UTRs may exhibit increased mRNA stability relative to their longer counterparts because of the absence of destabilization elements, thus contributing to their elevated accumulation during spermatogenesis. In turn, increased mRNA stability may facilitate continued protein synthesis during later stages of spermiogenesis following termination of gene transcription, as suggested for Pgk2 transcripts [54]. Further, it was recently shown that a shorter, testis-specific Bzw1 mRNA containing a truncated 3'UTR is translated with reduced efficiency relative to its longer isoforms [28]. Thus, selection of proximal, noncanonical poly(A) signals in male germ cells may lead to alternative mRNAs that are in some cases more stable and/or more poorly translated.
Elevated expression and novel isoforms of pre-mRNA cleavage/polyadenylation trans-acting factors both occur during spermatogenesis. Mouse male germ cells express very high amounts of Cstf2 as well as
Cstf2, a novel isoform of the cleavage stimulation factor that has been implicated in germ cell-specific polyadenylation [21]. Germ cell-enriched expression of a testis-specific form of PAP [23], as well as other 3'-end processing factors [8], has also been reported. In contrast to our results, the latter study [8] reported that Cpsf6 gene expression was down-regulated as mouse spermatogenesis proceeds based on analysis of microarray results. This divergent finding may reflect lack of detection of the truncated germ cell-enriched Cpsf6 mRNA within the original array chips, which can be sensitive to alternative poly(A) site usage [56]. Further, our findings show that human testis also uniquely expresses shorter mRNAs for both NUDT21 and CPSF6, suggesting that the general mechanisms controlling their formation are at least partially conserved in humans. One difference between the mouse and human was that these shorter mRNAs were not highly elevated relative to the longer transcript forms in human testis, although both CPSF6 mRNAs were highly elevated relative to those in somatic tissues. This may reflect distinct requirements for elevated mRNA abundance between these two species during spermatogenesis.
The significance of novel 3'-end processing factor expression for alternative polyadenylation in male germ cells remains to be clarified. Presumably, this reflects collaboration among different components of the cleavage/polyadenylation complex with cis-elements in germ cell pre-mRNAs. It was recently found that standard 3'-end processing sites occur less frequently for transcripts expressed in meiotic and spermiogenic germ cells [8], which may favor less stringent recognition of polyadenylation signals. Increased concentrations of cleavage/polyadenylation factors in combination with this cis organization may foster the utilization of noncanonical polyadenylation sites in later germ cell stages, which otherwise tend to be less efficiently processed [57]. Because pre-mRNA cleavage and transcription are coupled [10], scanning for the first suitable noncanonical polyadenylation site may lead to preferential generation of truncated 3'UTRs in male germ cells. Consistent with this, proximal poly(A) signals tend to be noncanonical in contrast to distal signals [57].
The present findings suggest that elevated levels of CFIm complexes coupled with the presence of neighboring UGUAN target sequences may promote the usage of proximal and less favorable A(A/U)UAAA-independent poly(A) signals. Therefore, NUDT21 and CPSF6 may be integral participants in male germ cell-specific alternative polyadenylation. In this context, it was recently found that the interaction of components of the RNA splicing and 3'-end processing complex with upstream U-rich elements promotes 3'-end formation at noncanonical poly(A) sites [15, 58]. Interestingly, CFIm interacts with the splicing factor U2AF2 [59] as well as with the CPSF subunit FIP1L1 [14], both of which are present at these upstream U-rich elements [14, 15]. Therefore, it is possible that CFIm and factors interacting with adjacent upstream U-rich element binding complex(es) functionally interact to promote usage of noncanonical poly(A) sites during spermatogenesis.
Finally, UGUA sequences within the 3'UTR of RINGO transcripts were recently shown to be part of translational repressor elements bound by Pumilio proteins in developing Xenopus oocytes [60]. Stage-dependent translational repression is a prominent mechanism of regulated gene expression during spermiogenesis [46]. These observations thus raise the interesting possibility that UGUA sequences present in spermatogenic transcripts have dual functions in certain instances, regulating both alternative 3'-end cleavage/polyadenylation of pre-mRNAs as well as stage-dependent mRNA translation.
ACKNOWLEDGMENTS
The authors would like to thank Mr. George Gagnon for his excellent technical assistance.
FOOTNOTES
1Supported by Public Service grant R01 HD45723. Core resources supported by the Diabetes Endocrinology Research Center grant DK32520 were also used. ![]()
Correspondence: 2FAX: 508 856 5997; e-mail: daniel.kilpatrick{at}umassmed.edu
3Current address: Department of Fisheries, Animal and Veterinary Science, University of Rhode Island, Kingston, RI 02881. ![]()
4Current address: Department of Urology, The Johns Hopkins University School of Medicine, Baltimore, MD 21287. ![]()
Received: 3 August 2007.
First decision: 28 August 2007.
Accepted: 13 November 2007.
REFERENCES
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |