Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print October 31, 2007.
Biol Reprod 2007, 10.1095/biolreprod.107.064634
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/4/568    most recent
biolreprod.107.064634v2
biolreprod.107.064634v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jincho, Y.
Right arrow Articles by Kono, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jincho, Y.
Right arrow Articles by Kono, T.
Agricola
Right arrow Articles by Jincho, Y.
Right arrow Articles by Kono, T.
BIOLOGY OF REPRODUCTION 78, 568–576 (2008)
DOI: 10.1095/biolreprod.107.064634
© 2008 by the Society for the Study of Reproduction, Inc.

Embryo; 

Identification of Genes Aberrantly Expressed in Mouse Embryonic Stem Cell-Cloned Blastocysts1

Yuko Jincho 3, Yusuke Sotomaru 4, Manabu Kawahara 3, Yukiko Ono 3, Hidehiko Ogawa 3, Yayoi Obata 3, and Tomohiro Kono 2 3

Department of Bioscience,3 Tokyo University of Agriculture, Tokyo 156-8502, Japan Natural Science Center for Basic Research and Development,4 Hiroshima University, Hiroshima 734-8551, Japan

ABSTRACT

During development, cloned embryos often undergo embryonic arrest at any stage of embryogenesis, leading to diverse morphological abnormalities. The long-term effects resulting from embryo cloning procedures would manifest after birth as early death, obesity, various functional disorders, and so forth. Despite extensive studies, the parameters affecting the developmental features of cloned embryos remain unclear. The present study carried out extensive gene expression analysis to screen a cluster of genes aberrantly expressed in embryonic stem cell-cloned blastocysts. Differential screening of cDNA subtraction libraries revealed 224 differentially expressed genes in the cloned blastocysts: eighty-five were identified by the BLAST search as known genes performing a wide range of functions. To confirm their differential expression, quantitative gene expression analyses were performed by real-time PCR using single blastocysts. The genes Skp1a, Canx, Ctsd, Timd2, and Psmc6 were significantly up-regulated, whereas Aqp3, Ak3l1, Rhot1, Sf3b3, Nid1, mt-Rnr2, mt-Nd1, mt-Cytb, and mt-Co2 were significantly down-regulated in the majority of embryonic stem cell-cloned embryos. Our results suggest that an extraordinarily high frequency of multiple functional disorders caused by the aberrant expression of various genes in the blastocyst stage is involved in developmental arrest and various other disorders in cloned embryos.

cDNA subtraction, early development, embryo, ES cell clone, gene expression, gene regulation, nuclear transfer

INTRODUCTION

Embryo cloning is not successful until appropriate epigenetic reprogramming is achieved in the donor nucleus. The process involved in the reprogramming of a donor nucleus is unclear; it undoubtedly occurs under the influence of unknown factors that are specific to metaphase II oocytes. Nuclear transfer often leads to the activation of genes necessary for early development and for the silencing of differentiation-associated genes that are transcribed in the original donor cells. Epigenetic reprogramming is believed to be associated with a certain degree of error. The cloned embryos may exhibit developmental failure along with various physiological and functional disorders. Although the cloned embryos may develop to term, long-term effects often manifest as abnormalities such as large offspring syndrome [1], placental enlargement [1, 2], adiposity [3, 4], respiratory defects [5], and immune defects [6, 7] and result in a short life span [8]. Interestingly, these peculiar clonal abnormalities are not transmitted to the descendant, suggesting that aberrant epigenetic modifications are amended in the germline [3, 9]. Recent reports show that the methylation status of the donor cells influences the efficiency of production of cloned individuals and embryonic stem (ES) cells from cloned embryos [10]. However, more data on this process is required for complete understanding of the entire mechanism of reprogramming.

There has been an enormous focus on understanding the mechanisms underlying various developmental defects in ES cell-cloned and somatic cell-cloned embryos; however, little is known regarding why only some cloned embryos can be reprogrammed to acquire totipotency, develop, and survive to adulthood. Therefore, numerous gene expression studies have been carried out thus far in cloned fetuses, pups, mice, cattle, sheep, pigs, and other species. In ES cell-cloned and somatic cell-cloned mouse fetuses, several imprinted genes showed unregulated expression at Embryonic Day (E) 9.5 [11, 12] and were accompanied by aberrant methylation of their respective regulatory domains [12]. Several global gene expression analyses, such as those involving microarray analysis of 10 000 genes conducted on samples from the neonatal placenta and liver show a cluster of abnormally expressed genes [13].

On the other hand, in order to gain further insight into the reasons behind the loss of embryos during the process of implantation, analyses of gene expression and epigenetic modifications have also been carried out in cloned preimplantation embryos [14, 15]. Immunostaining studies have been conducted to evaluate the reprogramming of epigenetic processes such as DNA methylation [16–20] and histone acetylation [21–23]. Expression of the pluripotent regulator gene Pou5f1 was detected only in 50% of the cloned blastocysts; however, the Cdx1 gene, which regulates the differentiation of the trophectoderm, was more frequently expressed [24, 25]. It has been reported that the highly methylated sequence of the regulatory region of the Pou5f1 gene in the donor cells is gradually demethylated in cloned embryos during preimplantation development [26]. Sebastiano et al. [27] performed gene expression analysis throughout the preimplantation development stage and observed that, despite the appropriate timing of the onset of gene expression, there was a high degree of variability in the number of transcripts found in somatic cell-cloned embryos. Although considerable information has been accumulated regarding gene expression in the preimplantation stage of ES cell-cloned and somatic cell-cloned embryos thus far, many factors are yet to be studied.

In this study, we performed subtraction analysis to obtain a profile of the genes that are aberrantly expressed in ES cell-cloned blastocysts. By comparing gene expression in the ES cell-cloned blastocysts with that in the controls, we performed a genetic search to identify the genes involved in developmental failure. The ES cell-cloned blastocysts would be a suitable subject to accomplish the aim of the present study. This is because the rate of development of the ES cell-cloned eggs to blastocysts was approximately 60% or higher (Fig. 1) [4, 28], and this is generally higher than that of somatic cell-cloned embryos in our laboratory. Furthermore, both the ES cell-cloned embryos and somatic cell-cloned embryos rapidly lost their developmental capability, resulting in the failure of implantation (Fig. 1) [28, 29] and of normal embryogenesis, showing placental malformation and fetal and placental overgrowth [4, 6]. The present study provides further insight into the features of ES cell-cloned blastocysts.


Figure 01
View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 1. Progress of developmental arrest in ES cell-cloned embryos during the developmental period. This figure is drawn from data provided in Dr. Ono's doctoral degree thesis [28]. A total of 770 embryos were reconstructed using TT2 ES cells (established from CBF1 [C57BL/6 x CBA] embryos); 449 ES cell-cloned blastocysts were transferred to 36 recipients, resulting in 23 live pups. The number on each bar represents the percentage of development.

MATERIALS AND METHODS

Animals

Adult female B6D2F1 (C57BL/6 x DBA/2) mice were obtained from Clea Japan Inc. During the course of the experiments, food and water were provided ad libitum to all the mice, and they were maintained at a controlled temperature (23°C ± 2°C) under 12L:12D conditions. All the mice were maintained and used in accordance with the guidelines for the care and use of laboratory animals, as specified by the Japanese Association for Laboratory Animal Science and by the Tokyo University of Agriculture.

Preparation of Donor ES Cells and Recipient Oocytes

The donor ES cells that were derived from B6CBF1 (C57BL/6 x CBA) embryos were prepared as described previously [4]. The ES cells were cultured for 3 days in collagen-coated dishes without a feeder layer in knockout Dulbecco modified Eagle medium (Invitrogen/Gibco) supplemented with 15% (v/v) fetal bovine serum (Invitrogen/Gibco) containing 103 U/ml leukemia inhibitory factor (ESGRO; Chemicon Int.) and the following reagents: 2 mM L-glutamine (Invitrogen/Gibco), 1% (v/v) nonessential amino acid solution (Invitrogen/Gibco), and 5.5 x 10–5 M 2-mercaptoethanol solution (Wako). In order to synchronize the cells at metaphase, we cultured them for 2 h in a medium containing 1 µg/ml nocodazole (Sigma-Aldrich), which is a microtubule polymerization inhibitor. The cells floating on the medium surface were collected in a transfer pipette, and only the cells arrested at metaphase were selected and used as nucleus donors.

Nuclear Transfer and Culture

Embryonic stem cell-cloned embryos were reconstructed by single nuclear transfer using the ES cells arrested at metaphase [4]. The recipient metaphase II oocytes were collected from mature B6D2F1 female mice after superovulation by consecutive injections of 5 IU eCG and 5 IU hCG. Micromanipulations were performed in the M2 medium containing 5 µg/ml cytochalasin B (Sigma-Aldrich) and 0.5 µg/ml nocodazole (Sigma) in a micromanipulation chamber. After removal of the metaphase II chromosomes, an ES cell arrested at metaphase was introduced into the perivitelline space of the enucleated oocyte with inactivated Sendai virus (HVJ, 2700 hemagglutinating activity units per µl). After 2 h, the oocytes that fused with a donor cell were activated artificially with 10 mM SrCl2 for 6 h. The activated embryos formed one polar body and one pronucleus and were selected and cultured in potassium simplex optimized medium [30] at 37°C for 4 days under an atmosphere of 5% CO2, 5% O2, and 90% N2. The ES cell-cloned blastocysts that hatched from the cutting slit of the zona pellucida were collected and used for molecular analysis. The well-expanded blastocysts derived from in vitro fertilized eggs were used as the control.

Cell Count at the Blastocyst Stage

Both ES cell-cloned and control blastocysts were exposed to 0.5% acid Tyrode (Sigma) for 30 sec to remove the zona pellucida. After three washes in 10 µl M2 medium, zona-free blastocysts were treated with 10% (v/v) anti-mouse whole serum (Sigma) for 40 min in M2 medium at 37°C and were subsequently washed three times in 10 µl M2 medium. After consecutive treatment with guinea pig complement (Sigma), the trophectoderm cells were permeabilized, whereas the inner cell mass remained intact. The treated blastocysts were then stained with 20 mg/ml Hoechst 33342 (Molecular Probes/Invitrogen) and 0.5 µg/ml propidium iodide (Sigma) for 40 min at room temperature. The cells of the inner cell mass and trophectoderm were then counted microscopically under UV fluorescence. Cells stained with blue fluorescence (Hoechst 33342) were from the intact inner cell mass, whereas the pink-stained cells were lysed trophectoderm cells.

Preparation of Total RNA and cDNA Subtraction Analysis

Total RNA was isolated using an RNeasy Mini Kit (Qiagen) from each of the 120 ES cell-cloned and control blastocysts. The blastocysts were immediately disrupted in 350 µl of Buffer RLT (Qiagen) and homogenized by vortexing. After 1 volume of 70% ethanol was added, each lysate was applied to an RNeasy Mini spin column. Total RNA was bound to the membrane and eluted in RNase-free water.

After DNase treatment, cDNA was synthesized and then amplified by using the SMART PCR cDNA Synthesis Kit (Clontech) according to the manufacturer's instructions. We performed cDNA subtraction by using a PCR-Select cDNA Subtraction Kit (Clontech) according to the manufacturer's instructions. The subtracted PCR products were subcloned into the pGEM-T Easy Vector (Promega Corp). Differential screening of the subtracted clones was performed by using the PCR-Select Differential Screening Kit (Clontech). The inserts of the subtracted clones were amplified by PCR using forward (TCGAGCGGCCGCCCGGGCAGGT) and reverse (AGCGTGGTCGCGGCCGAGGT) polylinker primers, and the PCR products were immobilized onto nylon membranes in triplicate.

Hybridization probes were prepared by labeling the forward- and reverse-subtracted cDNA (20–90 µg) and forward- and reverse-unsubtracted cDNA (50–100 µg) libraries with digoxigenin (DIG) (Roche Molecular Biochemicals). Subsequently, the PCR products immobilized on the nylon membranes were hybridized with 100 ng of each probe that was prepared in ExpressHyb Hybridization Solution (Clontech) for 60 min at 72°C. After washing, the hybridization signals of the membrane were read using a Fujifilm LAS-1000 Plus camera (Fujifilm), and the intensity was computed using Fujifilm ArrayGauge software (Fujifilm). Complementary DNA clones that hybridized to the forward-subtracted and forward-unsubtracted probes but not to reverse-subtracted and reverse-unsubtracted probes were determined to be specific to the ES cell-cloned blastocysts. The results of the differential screening revealed that certain cDNA clones showed more than a 2-fold increase in expression in an ES cell-cloned embryo as compared to a control embryo; these were classified as up-regulated genes. Correspondingly, the cDNA clones from an ES cell-clone whose respective signal strengths were 2-fold weaker than those of the control were classified as down-regulated.

Quantitative Gene Expression Analysis

Complementary DNA was synthesized from single blastocysts by using a Cells-to-cDNA II Kit (Ambion/Applied Biosystems). Single blastocysts were placed in 13 µl of the lysis buffer and then treated with DNase. Complementary DNAs were synthesized by using a SuperScript RNase H-Reverse Transcriptase Kit (Invitrogen) in 20 µl of a reaction solution. Further, this synthesized cDNA was employed for quantitative gene expression analysis performed using real-time quantitative reverse transcriptase PCR carried out by means of a ready-to-use reaction mixture kit (LightCycler FirstStart DNA Master SYBR Green I; Roche Molecular Biochemicals). The primer sequences used for the PCR reaction, the PCR conditions, and the product sizes are listed in Table 1. The Gapdh gene was used as the loading control. The amplification protocol was as follows: DNA polymerase activation at 95°C for 10 min, 45 cycles of amplification, denaturation at 95°C for 15 sec, annealing for 10 sec at the optimum temperature for each gene (see Table 1), and extension at 72°C for 10 sec. At the end of these amplification cycles, a melting curve analysis was performed to verify specific amplification. The relative expression levels of each gene tested were obtained using a standard curve that was generated using a pooled cDNA mixture extracted from E12.5 fetuses.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 1. Cell numbers of ES cell-cloned and control blastocysts.

Statistical Analysis

The gene expression levels were statistically analyzed by the Student t-test. Differences were considered significant when P < 0.05. In order to elucidate the functional network of the genes that were differentially expressed in the ES cell-cloned blastocysts and those that were differentially expressed in the control blastocysts, the gene lists were integrated into the Ingenuity Pathway Analysis database (Ingenuity, www.ingenuity.com).

RESULTS

Identification of Differentially Expressed Genes

We identified the differentially expressed genes in the ES cell-cloned blastocysts by using a subtractive cDNA cloning approach. The quality of the ES cell-cloned blastocysts was accessed by counting the cell numbers of the trophectoderm and inner cell mass using double-fluorescence staining (Table 2, Fig. 2). The results clearly showed that the ES cell-cloned blastocysts had a similar number of cells to that of the controls. Complementary DNA subtraction of these two genotypes of embryo populations was carried out by using the PCR-Select Subtraction Kit (Clontech), which combines the normalization and equalization of cDNA with the subtractive process. From the subtracted cDNA libraries, 2304 cDNA clones were subcloned, and the forward and reverse sequences were subjected to probe hybridization in order to identify the differentially expressed genes (Table 3). We sequenced a total of 224 subtracted clones that demonstrated approximately 2-fold or greater differences in the intensity of the hybridization signal, and the identities of 198 genes were determined by online BLAST analysis (www.ncbi.nlm.nih.gov/BLAST). They comprised 85 known (47 up-regulated and 38 down-regulated) and 46 novel or uncharacterized (18 up-regulated and 28 down-regulated) genes. The number of known genes constitutes the number of genes calculated after excluding the overlapping ones.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 2. Primers and conditions used for real-time PCR.


Figure 02
View larger version (78K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 2. Detection of the inner cell mass and trophectoderm cell numbers by double staining. Fluorescent and bright field images of the ES cell-cloned (a and b) and control (c and d) blastocysts. The inner cell mass was stained only with Hoechst 33342 and consequently appeared blue, whereas the trophectoderm was stained with both Hoechst and propidium iodide and consequently appeared pink under UV light. Original magnification x400.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 3. Differential screening of genes aberrantly expressed in ES cell-cloned blastocysts by subtraction analysis.

The results of the cluster analysis revealed that the up-regulated genes in the ES cell-cloned blastocysts were mainly responsible for enzyme activities, DNA binding, receptor activity, protein binding, and ion binding; however, the down-regulated genes were mainly responsible for enzyme activities, ion binding, and maintaining cell structure (Table 4). In order to obtain further insight into the function of the aberrantly expressed genes, we obtained the following five functional networks of the genes by using the International Pharmaceutical Abstracts (IPA) database: 1) network 1 (Sf3b3): posttranslational modification, protein folding, and cell morphology; 2) network 2 (Aqp3): DNA replication, recombination, and repair; cell cycle regulation; and cellular assembly and organization; 3) network 3 (Nid1, Timd2, Canx, and Ptgs2 [also known as Cox2]): lipid metabolism, small molecule biochemistry, and cell death; 4) network 4 (Ctsd and Skp1a): DNA replication, recombination, and repair; cell cycle regulation; and connective tissue development and function; 5) network 5 (Ak3l1 and Psmc6): cellular assembly and organization, anticancer effect, and cell cycle regulation (Fig. 3).


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 4. Functional clustering of up-regulated and down-regulated genes in ES cell-cloned blastocysts based on the Ingenuity Pathway Analysis database.


Figure 03
View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 3. Functional networks of genes aberrantly expressed in the ES cell-cloned blastocysts based on the Ingenuity Pathway Analysis database. Genes marked in red and green are up-regulated and down-regulated, respectively. The dark red color indicates that, as a result of differential screening, gene expression in the ES cell-cloned embryos was up-regulated by more than 2-fold as compared to the control. Similarly, the dark green color shows that gene expression in the control was down-regulated by more than 2-fold as compared to an ES cell-cloned blastocyst. The straight and dashed lines indicate direct and indirect interactions, respectively, between the gene products.

Gene Expression Analysis of Single Blastocysts by Quantitative Real-Time PCR

To confirm the aberrant expression of each gene, we performed a quantitative gene expression analysis by real-time PCR in each of the 11–13 blastocysts derived from the ES cell clones and controls. The Gapdh, which was the tested internal control, showed almost equal expression between the ES cell-cloned and control blastocysts. The results of real-time PCR correlated rather well with the results of the subtraction analysis (Fig. 4). The Skp1a and Canx genes were expressed at significantly higher levels (P < 0.05) in the ES cell-cloned blastocysts than in the control blastocysts. Although the mean expression levels of the Ctsd, Timd2, and Psmc6 genes were high in the ES cell-cloned blastocysts, these values were not significant because the expression levels of these genes varied remarkably in each sample and were distributed across a wide range. With regard to the down-regulated genes in the ES cell-cloned embryos that were identified by subtraction cDNA cloning, the expression of 10 genes was quantitatively tested by real-time PCR. Of these, with the exception of Rhot1, Clf2, and Nid1, seven genes were confirmed to be significantly down-regulated in the ES cell-cloned blastocysts. The expression of four mitochondrial genes—mt-Nd1, mt-Co2, mt-Rnr2, and mt-Cytb—was reduced to 30%–50% of that of the controls. The expression of Aqp3 in the ES cell-cloned embryos was clearly reduced to 30% of that of the control. Quantitative gene expression analysis of individual blastocysts revealed that the level of gene expression is not always distributed over a wide range in the ES cell-cloned embryos. Generally, the gene expression levels in embryos show a wide range of variation; therefore, comparing the gene expression levels for evaluating the features of preimplantation embryos can occasionally be difficult.


Figure 04
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 4. Quantitative gene expression analysis in individual ES cell-cloned blastocysts. The genes were selected from the list of genes aberrantly expressed in the ES cell-cloned blastocysts, as determined by cDNA subtraction analysis. For analyzing the expression of each gene, 11–13 blastocysts were used. The expression level of Gapdh was calculated by analyzing 71 ES cell-cloned blastocysts and 66 control blastocysts. The box-plot graphs represent the relative expression levels of the ES cell-cloned and control blastocysts. The two quartiles, namely, the 25th and 75th percentiles, form the box, with the median marked as a line, and the maximum and minimum values form the whiskers within the acceptable range that is defined by the two quartiles. The circles denote the outliers, in other words, values outside the acceptable range. Asterisks denote a significant difference from control (P < 0.05).

DISCUSSION

Inappropriate reprogramming frequently occurs in ES cell-cloned and somatic cell-cloned embryos, thereby resulting in various dysregulated gene expression patterns and epigenetic modifications such as DNA methylation. Currently available data regarding the gene expression of ES cell-cloned and somatic cell-cloned embryos in the preimplantation stage remain fragmented and limited. In this study, we identified the aberrantly expressed genes in the ES cell-cloned blastocysts by cDNA subtraction analysis.

Thus far, only a few reports have examined gene expression in somatic cell-cloned embryos during preimplantation; however, some interesting and noteworthy results have been reported by independent groups. Sebastiano et al. [27] reported the results of tests that were conducted to determine the onset and levels of expression of several genes, namely, Hprt, Tsx, Bex1, Bax, Cpt2, and Pou5f1, in somatic cell-cloned preimplantation-stage embryos. The results indicate a high degree of variability in the number of transcripts found in the somatic cell-cloned embryos, despite the appropriate timing of the onset of gene expression. Furthermore, zygotically activated genes, which are generally activated at the 2-cell stage in fertilized embryos, were suppressed in 2-cell somatic cell-cloned mouse embryos [31]. The appropriate expression of the genes responsible for the undifferentiated status of cells might be reflected by the degree of reprogramming in the somatic cell-cloned and ES cell-cloned embryos. However, the data obtained thus far vary across reports. Immunohistochemical experiments revealed that Pou5f1 was expressed at the appropriate stage in the somatic cell-cloned embryos that harbored Tg(Pou5f1-EGFP)11lmeg; however, the experiments also revealed an incorrect spatial expression of this gene in a majority of blastocysts [24]. Additionally, Pou5f1 signals were not detected in 50% of the somatic cell-cloned blastocysts [20, 25]. Gene expression analysis showed that the expression of Sox2 and Pou5f1 but not of Nanog, Stat3, Fgf4, and Dppa3 (also known as Stella) were down-regulated in the somatic cell-cloned and ES cell-cloned blastocysts [32, 33]. However, Suzuki et al. [31] also reported that the expressions of Pou5f1 and Cdx1 were normal in the somatic cell-cloned blastocysts. Here, we also observed that Pou5f1 and other stem cell-related genes could not be identified in the cDNA subtraction libraries of the ES cell-cloned blastocysts. Therefore, the abundant expression of these genes at the blastocyst stage did not significantly differ between the cloned and fertilized embryos. This idea might be supported by the evidence that ES cells can be established easily from somatic cell-cloned embryos rather than from in vitro fertilized embryos [2, 34–38].

In order to evaluate the precision of the cDNA subtraction libraries of the ES cell-cloned blastocysts, we determined the expression levels of 15 genes by real-time PCR. An important feature is that the mitochondrial genes were repeatedly cloned in the present subtraction analysis, suggesting that their expressions were abundant. Interestingly, functional clustering analysis by the IPA program showed that the functions of the genes inappropriately expressed in the ES cell-cloned blastocysts varied over a wide range. Clear differences were observed in the functional diversity between the up- and down-regulated gene clusters. Among the up-regulated genes, 11 were classified into the class of genes involved in cell death. In contrast, a large number of the down-regulated genes (23%) with various metabolic functions remained unknown. Global gene expression analysis in the bovine blastocyst has been performed, and it was reported that aberrantly expressed genes involved in cytoskeletal signaling, receptor activity, and metabolism function were detected by microarray analysis [15, 39–41]. Based on these findings, it is suggested that the rapid and drastic reduction in the developmental competence of the ES cell-cloned blastocysts is caused by multiple gene dysfunction.

The proteins encoded by the mt-Nd1, mt-Cytb, and mt-Co2 genes are located in the mitochondrial inner membrane and are involved in oxidative phosphorylation as components of NADH dehydrogenase, the cytochrome bc1 complex, and cytochrome c oxidase, respectively [42, 43]. Down-regulation of these genes in ES cell-cloned blastocysts would cause ATP deficiency, thereby decreasing cell proliferation [44, 45] and leading to implantation failure [46]. Furthermore, it has been suggested that in the Xenopus species, ATP-dependent reactions would affect the reprogramming of donor nuclei following nuclear transfer. The reprogramming ability of the egg extracts was degraded because the activity of the chromatin-remodeling ATPase BRG1 was abolished by antibody depletion or dominant negative expression. It has also been shown that the imitation switch (ISWI) protein, which is a chromatin-remodeling ATPase, detaches the TATA-binding protein from the nuclear matrix [47]. The 16S rRNA ribosomal large subunit assembly that is necessary for mt-Rnr gene expression was also down-regulated. It is well known that cytochrome c, which functions as a caspase activator, is extruded from the mitochondria via an intrinsic pathway and leads to the activation of procaspase 9, thereby resulting in apoptosis [44, 48]. A disorder in the mitochondrial gene cluster might lead to apoptosis in the ES cell-cloned embryos. The suppression of these genes and that of Rhot1 might occur via mitochondrial homeostasis and apoptosis because the overexpression of a constitutively active mutant of the Rho family of genes induced an aggregation of the mitochondrial network and resulted in an increased rate of cell apoptosis [49, 50]. Furthermore, cloned embryos that are reconstructed using different sources of donor cells and cytoplasm exhibit mitochondrial heteroplasmy. This may not hamper the developmental processes in somatic cell-cloned embryos. Takeda et al. [51] demonstrated that injecting mitochondria derived from the Domesticus species into parthenogenetically activated mouse eggs had no effect on development. This may be because the mitochondrial electron-transport system in the heteroplasmic embryos is maintained. The function of the mitochondrial electron-transport system remains unaltered in the mouse cells devoid of mitochondrial DNA, unlike in the substrain with the mouse-derived mitochondrial DNA [52].

Placental dysplasia with hypertrophy is often observed in somatic [1, 2, 4] and embryonic [53] clones. Successful placentation is associated with the normal differentiation of primary and secondary trophoblastic giant cells [53]. In mice, Ctsd is known to encode a proteolytic enzyme and is believed to be involved in trophoblastic invasion during implantation [54, 55]. In the present study, Ctsd expression was remarkably up-regulated in the ES cell-cloned blastocysts, and this might have caused the implantation failure, because Ctsd inhibits the function of insulin-like growth factor II (IGF-II), a major cell proliferation factor, by degrading the IGF-II-binding proteins [56–59]. Furthermore, the evident suppression of Aqp3, which plays a key role in transtrophectodermal water movement during cavitation, could also exert adverse effects on implantation [60, 61].

Consistent with the findings of previous reports, the present study suggests that the acute regression of developmental competence in ES cell-cloned blastocysts is caused by multiple obstacles due to incomplete reprogramming after the transfer of the donor nucleus into enucleated metaphase II oocytes. Although dysfunctional genes related to mitochondria and implantation may be involved in the postimplantation development of ES cell-cloned embryos, further studies are necessary for outlining the molecular mechanisms underlying successful development.

FOOTNOTES

1Supported by grants-in-aid from the Ministry of Education, Science, Sports and Culture of Japan and from the Ministry of Agriculture, Forestry and Fisheries of Japan (Development of stable production technology of cloned animals by somatic cell nuclear transfer) to T.K. Back

Correspondence: 2Tomohiro Kono, Department of Bioscience, Tokyo University of Agriculture 1-1-1, Sakuragaoka, Setagaya-ku, Tokyo 156-8502, Japan. FAX: 81 3 5477 2543; e-mail: tomohiro{at}nodai.ac.jp

Received: 30 July 2007.

First decision: 17 August 2007.

Accepted: 26 October 2007.

REFERENCES

  1. ; : Ono Y, Shimozawa N, Ito M, Kono T. Cloned mice from fetal fibroblast cells arrested at metaphase by a serial nuclear transfer. Biol Reprod 2001 6444–50[Abstract/Free Full Text]
  2. ; : Wakayama T, Rodriguez I, Perry AC, Yanagimachi R, Mombaerts P. Mice cloned from embryonic stem cells. Proc Natl Acad Sci U S A 1999 9614984–14989[Abstract/Free Full Text]
  3. ; : Tamashiro KL, Wakayama T, Akutsu H, Yamazaki Y, Lachey JL, Wortman MD, Seeley RJ, D'Alessio DA, Woods SC, Yanagimachi R, Sakai RR. Cloned mice have an obese phenotype not transmitted to their offspring. Nat Med 2002 8262–267[CrossRef][Medline]
  4. ; : Tamashiro KL, Wakayama T, Blanchard RJ, Blanchard DC, Yanagimachi R. Postnatal growth and behavioral development of mice cloned from adult cumulus cells. Biol Reprod 2000 63328–334[Abstract/Free Full Text]
  5. ; : Ono Y, Shimozawa N, Muguruma K, Kimoto S, Hioki K, Tachibana M, Shinkai Y, Ito M, Kono T. Production of cloned mice from embryonic stem cells arrested at metaphase. Reproduction 2001 122731–736[Abstract]
  6. ; : Inoue K, Wakao H, Ogonuki N, Miki H, Seino K, Nambu-Wakao R, Noda S, Miyoshi H, Koseki H, Taniguchi M, Ogura A. Generation of cloned mice by direct nuclear transfer from natural killer T cells. Curr Biol 2005 151114–1118[CrossRef][Medline]
  7. ; : Ogura A, Inoue K, Ogonuki N, Noguchi A, Takano K, Nagano R, Suzuki O, Lee J, Ishino F, Matsuda J. Production of male cloned mice from fresh, cultured, and cryopreserved immature Sertoli cells. Biol Reprod 2000 621579–1584[Abstract/Free Full Text]
  8. ; : Ogonuki N, Inoue K, Yamamoto Y, Noguchi Y, Tanemura K, Suzuki O, Nakayama H, Doi K, Ohtomo Y, Satoh M, Nishida A, Ogura A. Early death of mice cloned from somatic cells. Nat Genet 2002 30253–254[CrossRef][Medline]
  9. ; : Shimozawa N, Ono Y, Kimoto S, Hioki K, Shinkai Y, Kono T, Ito M. Abnormalities in cloned mice are not transmitted to the progeny. Genesis 2002 34203–207[CrossRef][Medline]
  10. ; : Blelloch R, Wang Z, Meissner A, Pollard S, Smith A, Jaenisch R. Reprogramming efficiency following somatic cell nuclear transfer is influenced by the differentiation and methylation state of the donor nucleus. Stem Cells 2006 242007–2013[Abstract/Free Full Text]
  11. ; : . Inoue K, Kohda T, Lee J, Ogonuki N, Mochida K, Noguchi Y, Tanemura K, Kaneko-Ishino T, Ishino F, Ogura A. Faithful expression of imprinted genes in cloned mice. Science 2002 295297[Free Full Text]
  12. ; : Ogawa H, Ono Y, Shimozawa N, Sotomaru Y, Katsuzawa Y, Hiura H, Ito M, Kono T. Disruption of imprinting in cloned mouse fetuses from embryonic stem cells. Reproduction 2003 126549–557[Abstract]
  13. ; : Humpherys D, Eggan K, Akutsu H, Friedman A, Hochedlinger K, Yanagimachi R, Lander ES, Golub TR, Jaenisch R. Abnormal gene expression in cloned mice derived from embryonic stem cell and cumulus cell nuclei. Proc Natl Acad Sci U S A 2002 9912889–12894[Abstract/Free Full Text]
  14. ; : Renard JP, Chastant S, Chesne P, Richard C, Marchal J, Cordonnier N, Chavatte P, Vignon X. Lymphoid hypoplasia and somatic cloning. Lancet 1999 3531489–1491[CrossRef][Medline]
  15. ; : Smith SL, Everts RE, Tian XC, Du F, Sung LY, Rodriguez-Zas SL, Jeong BS, Renard JP, Lewin HA, Yang X. Global gene expression profiles reveal significant nuclear reprogramming by the blastocyst stage after cloning. Proc Natl Acad Sci U S A 2005 10217582–17587[Abstract/Free Full Text]
  16. ; : Armstrong L, Lako M, Dean W, Stojkovic M. Epigenetic modification is central to genome reprogramming in somatic cell nuclear transfer. Stem Cells 2006 24805–814[Abstract/Free Full Text]
  17. ; : Chung YG, Ratnam S, Chaillet JR, Latham KE. Abnormal regulation of DNA methyltransferase expression in cloned mouse embryos. Biol Reprod 2003 69146–153[Abstract/Free Full Text]
  18. ; : Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 2001 9813734–13738[Abstract/Free Full Text]
  19. ; : Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, Han YM. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001 28173–177[CrossRef][Medline]
  20. ; : Ohgane J, Wakayama T, Kogo Y, Senda S, Hattori N, Tanaka S, Yanagimachi R, Shiota K. DNA methylation variation in cloned mice. Genesis 2001 3045–50[CrossRef][Medline]
  21. ; : Enright BP, Kubota C, Yang X, Tian XC. Epigenetic characteristics and development of embryos cloned from donor cells treated by trichostatin A or 5-aza-2'-deoxycytidine. Biol Reprod 2003 69896–901[Abstract/Free Full Text]
  22. ; : Wee G, Koo DB, Song BS, Kim JS, Kang MJ, Moon SJ, Kang YK, Lee KK, Han YM. Inheritable histone H4 acetylation of somatic chromatins in cloned embryos. J Biol Chem 2006 2816048–6057[Abstract/Free Full Text]
  23. ; : Santos F, Zakhartchenko V, Stojkovic M, Peters A, Jenuwein T, Wolf E, Reik W, Dean W. Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr Biol 2003 131116–1121[CrossRef][Medline]
  24. ; : Boiani M, Eckardt S, Scholer HR, McLaughlin KJ. Oct4 distribution and level in mouse clones: consequences for pluripotency. Genes Dev 2002 161209–1219[Abstract/Free Full Text]
  25. ; : Kishigami S, Hikichi T, Van Thuan N, Ohta H, Wakayama S, Bui HT, Mizutani E, Wakayama T. Normal specification of the extraembryonic lineage after somatic nuclear transfer. FEBS Lett 2006 5801801–1806[CrossRef][Medline]
  26. ; : Yamazaki Y, Fujita TC, Low EW, Alarcon VB, Yanagimachi R, Marikawa Y. Gradual DNA demethylation of the Oct4 promoter in cloned mouse embryos. Mol Reprod Dev 2006 73180–188[CrossRef][Medline]
  27. ; : Sebastiano V, Gentile L, Garagna S, Redi CA, Zuccotti M. Cloned pre-implantation mouse embryos show correct timing but altered levels of gene expression. Mol Reprod Dev 2005 70146–154[CrossRef][Medline]
  28. Production of somatic and ES cloned mice by the novel cloning procedures and analysis of their developmental competence . . Ono Y. 2003Tokyo, Japan: Tokyo University of Agriculture; Thesis
  29. ; : Wakayama T and Yanagimachi R. Cloning of male mice from adult tail-tip cells. Nat Genet 1999 22127–128[CrossRef][Medline]
  30. ; : Erbach GT, Lawitts JA, Papaioannou VE, Biggers JD. Differential growth of the mouse preimplantation embryo in chemically defined media. Biol Reprod 1994 501027–1033[Abstract]
  31. ; : Suzuki T, Minami N, Kono T, Imai H. Zygotically activated genes are suppressed in mouse nuclear transferred embryos. Cloning Stem Cells 2006 8295–304[CrossRef][Medline]
  32. ; : Hochedlinger K and Jaenisch R. Monoclonal mice generated by nuclear transfer from mature B and T donor cells. Nature 2002 4151035–1038[CrossRef][Medline]
  33. ; : Li X, Amarnath D, Kato Y, Tsunoda Y. Analysis of development-related gene expression in cloned bovine blastocysts with different developmental potential. Cloning Stem Cells 2006 841–50[CrossRef][Medline]
  34. ; : Bortvin A, Eggan K, Skaletsky H, Akutsu H, Berry DL, Yanagimachi R, Page DC, Jaenisch R. Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development 2003 1301673–1680[Abstract/Free Full Text]
  35. ; : Brambrink T, Hochedlinger K, Bell G, Jaenisch R. ES cells derived from cloned and fertilized blastocysts are transcriptionally and functionally indistinguishable. Proc Natl Acad Sci U S A 2006 103933–938[Abstract/Free Full Text]
  36. ; : Inoue K, Ogonuki N, Mochida K, Yamamoto Y, Takano K, Kohda T, Ishino F, Ogura A. Effects of donor cell type and genotype on the efficiency of mouse somatic cell cloning. Biol Reprod 2003 691394–1400[Abstract/Free Full Text]
  37. ; : Kishigami S, Wakayama S, van Thuan N, Wakayama T. Cloned mice and embryonic stem cell establishment from adult somatic cells. Hum Cell 2006 192–10[CrossRef][Medline]
  38. ; : Zieve GVB, Turnbull D, Mullins JM. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Exp Cell Res 1980 126397–405[CrossRef][Medline]
  39. ; : Pfister-Genskow M, Myers C, Childs LA, Lacson JC, Patterson T, Betthauser JM, Goueleke PJ, Koppang RW, Lange G, Fisher P, Watt SR, Forsberg EJ, Zheng Y, Leno GH, Schultz RM, Liu B, Chetia C, Yang X, Hoeschele I, Eilertsen KJ. Identification of differentially expressed genes in individual bovine preimplantation embryos produced by nuclear transfer: improper reprogramming of genes required for development. Biol Reprod 2005 72546–555[Abstract/Free Full Text]
  40. ; : Somers J, Smith C, Donnison M, Wells DN, Henderson H, McLeay L, Pfeffer PL. Gene expression profiling of individual bovine nuclear transfer blastocysts. Reproduction 2006 1311073–1084[Abstract/Free Full Text]
  41. ; : Beyhan Z, Ross PJ, Iager AE, Kocabas AM, Cunniff K, Rosa GJ, Cibelli JB. Transcriptional reprogramming of somatic cell nuclei during preimplantation development of cloned bovine embryos. Dev Biol 2007 305637–649[CrossRef][Medline]
  42. ; : Fulka J Jr, Leibfried-Rutledge ML, First NL. Control of germinal vesicle breakdown in bovine x murine hybrid oocytes. Reprod Nutr Dev 1993 33411–417[CrossRef][Medline]
  43. Mitochondrial Function and Biogenesis . : Nijtnans L. Function and dysfunction of the oxidative phosphorylation system. 2004Berlin, Germany: Springer-Verlag;149–176. In:
  44. ; : Campbell KHS, Ritchie WA, Wilmut I. Nuclear-cytoplasmic interactions during the first cell cycle of nuclear transfer reconstructed bovine embryos: implications for deoxyribonucleic acid replication and development. Biol Reprod 1993 49933–942[Abstract]
  45. ; : Dumollard R, Duchen M, Carroll J. The role of mitochondrial function in the oocyte and embryo. Curr Top Dev Biol 2007 7721–49[Medline]
  46. ; : Sun-Wada G, Murata Y, Yamamoto A, Kanazawa H, Wada Y, Futai M. Acidic endomembrane organelles are required for mouse postimplantation development. Dev Biol 2000 228315–325[CrossRef][Medline]
  47. ; : Kikyo N, Wade PA, Guschin D, Ge H, Wolffe AP. Active remodeling of somatic nuclei in egg cytoplasm by the nucleosomal ATPase ISWI. Science 2000 2892360–2362[Abstract/Free Full Text]
  48. ; : Little SA and Mirkes PE. Teratogen-induced activation of caspase-9 and the mitochondrial apoptotic pathway in early postimplantation mouse embryos. Toxicol Appl Pharmacol 2002 181142–151[CrossRef][Medline]
  49. ; : Fransson A, Ruusala A, Aspenstrom P. Atypical Rho GTPases have roles in mitochondrial homeostasis and apoptosis. J Biol Chem 2003 2786495–6502[Abstract/Free Full Text]
  50. ; : Smith L and Wilmut I. Analysis of the third and fourth cell cycles of mouse early development. Biol Reprod 1986 401027–1035[CrossRef]
  51. ; : Takeda K, Tasai M, Iwamoto M, Onishi A, Tagami T, Nirasawa K, Hanada H, Pinkert CA. Microinjection of cytoplasm or mitochondria derived from somatic cells affects parthenogenetic development of murine oocytes. Biol Reprod 2005 721397–1404[Abstract/Free Full Text]
  52. ; : Yamaoka M, Isobe K, Shitara H, Yonekawa H, Miyabayashi S, Hayashi JI. Complete repopulation of mouse mitochondrial DNA-less cells with rat mitochondrial DNA restores mitochondrial translation but not mitochondrial respiratory function. Genetics 2000 155301–307[Abstract/Free Full Text]
  53. ; : Ono Y and Kono T. Irreversible barrier to the reprogramming of donor cells in cloning with mouse embryos and embryonic stem cells. Biol Reprod 2006 75210–216[Abstract/Free Full Text]
  54. ; : Afonso S, Romagnano L, Babiarz B. Expression of cathepsin proteinases by mouse trophoblast in vivo and in vitro. Dev Dyn 1999 216374–384[CrossRef][Medline]
  55. ; : Savatier P, Huang S, Szekely L, Wiman KG, Samarut J. Contrasting patterns of retinoblastoma protein expression in mouse embryonic stem cells and embryonic fibroblasts. Oncogene 1994 9809–818[Medline]
  56. ; : Braulke T, Claussen M, Saftig P, Wendland M, Neifer K, Schmidt B, Zapf J, von Figura K, Peters C. Proteolysis of IGFBPs by cathepsin D in vitro and in cathepsin D-deficient mice. Prog Growth Factor Res 1995 6265–271[CrossRef][Medline]
  57. ; : Claussen M, Kubler B, Wendland M, Neifer K, Schmidt B, Zapf J, Braulke T. Proteolysis of insulin-like growth factors (IGF) and IGF binding proteins by cathepsin D. Endocrinology 1997 1383797–3803[Abstract/Free Full Text]
  58. ; : Zhou Q, Jouneau A, Brochard V, Adenot P, Renard JP. Developmental potential of mouse embryos reconstructed from metaphase embryonic stem cell nuclei. Biol Reprod 2001 65412–419[Abstract/Free Full Text]
  59. ; : Yabuuchi A, Yasuda Y, Kato Y, Tsunoda Y. Effects of nuclear transfer procedures on ES cell cloning efficiency in the mouse. J Reprod Dev 2004 50263–268[CrossRef][Medline]
  60. ; : Barcroft LC, Offenberg H, Thomsen P, Watson AJ. Aquaporin proteins in murine trophectoderm mediate transepithelial water movements during cavitation. Dev Biol 2003 256342–354[CrossRef][Medline]
  61. ; : Miki H, Inoue K, Ogonuki N, Mochida K, Nagashima H, Baba T, Ogura A. Cytoplasmic asters are required for progression past the first cell cycle in cloned mouse embryos. Biol Reprod 2004 712022–2028[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. Kawahara, S. Morita, N. Takahashi, and T. Kono
Defining Contributions of Paternally Methylated Imprinted Genes at the Igf2-H19 and Dlk1-Gtl2 Domains to Mouse Placentation by Transcriptomic Analysis
J. Biol. Chem., June 26, 2009; 284(26): 17751 - 17765.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/4/568    most recent
biolreprod.107.064634v2
biolreprod.107.064634v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jincho, Y.
Right arrow Articles by Kono, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jincho, Y.
Right arrow Articles by Kono, T.
Agricola
Right arrow Articles by Jincho, Y.
Right arrow Articles by Kono, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS