Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print December 19, 2007.
Biol Reprod 2007, 10.1095/biolreprod.107.065987
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/4/601    most recent
biolreprod.107.065987v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, B.
Right arrow Articles by Bishop, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, B.
Right arrow Articles by Bishop, C. E.
Agricola
Right arrow Articles by Lu, B.
Right arrow Articles by Bishop, C. E.
BIOLOGY OF REPRODUCTION 78, 601–610 (2008)
DOI: 10.1095/biolreprod.107.065987
© 2008 by the Society for the Study of Reproduction, Inc.

Gamete Biology; 

A Mutation in the Inner Mitochondrial Membrane Peptidase 2-Like Gene (Immp2l) Affects Mitochondrial Function and Impairs Fertility in Mice1

Baisong Lu 4, Christophe Poirier 3 6, Tamas Gaspar 5, Christian Gratzke 4, Wilbur Harrison 7, David Busija 5, Martin M. Matzuk 7 8, Karl-Erik Andersson 4, Paul A. Overbeek 7, and Colin E. Bishop 2 4 6

Institute for Regenerative Medicine4 and Department of Physiology and Pharmacology,5 Wake Forest University School of Medicine, Wake Forest University Health Sciences, Winston-Salem, North Carolina 27157 Departments of Obstetrics and Gynecology,6 Molecular and Cellular Biology,7 and Pathology,8 Baylor College of Medicine, Houston, Texas 77030

ABSTRACT

The mitochondrion is involved in energy generation, apoptosis regulation, and calcium homeostasis. Mutations in genes involved in mitochondrial processes often result in a severe phenotype or embryonic lethality, making the study of mitochondrial involvement in aging, neurodegeneration, or reproduction challenging. Using a transgenic insertional mutagenesis strategy, we generated a mouse mutant, Immp2lTg(Tyr)979Ove, with a mutation in the inner mitochondrial membrane peptidase 2-like (Immp2l) gene. The mutation affected the signal peptide sequence processing of mitochondrial proteins cytochrome c1 and glycerol phosphate dehydrogenase 2. The inefficient processing of mitochondrial membrane proteins perturbed mitochondrial function so that mitochondria from mutant mice manifested hyperpolarization, higher than normal superoxide ion generation, and higher levels of ATP. Homozygous Immp2lTg(Tyr)979Ove females were infertile due to defects in folliculogenesis and ovulation, whereas mutant males were severely subfertile due to erectile dysfunction. The data suggest that the high superoxide ion levels lead to a decrease in the bioavailability of nitric oxide and an increase in reactive oxygen species stress, which underlies these reproductive defects. The results provide a novel link between mitochondrial dysfunction and infertility and suggest that superoxide ion targeting agents may prove useful for treating infertility in a subpopulation of infertile patients.

erectile dysfunction, follicular development, folliculogenesis, Immp2l, male sexual function, mitochondrion, nitric oxide, ovulation, spermatogenesis, superoxide

INTRODUCTION

Mitochondria play critical roles in cellular energy production, regulation of apoptosis, and intracellular calcium homeostasis [1]. They are also the primary sources of endogenous reactive oxygen species (ROS). Mitochondrial dysfunction has been associated with a wide range of human conditions including atherosclerosis and cardiovascular disease [2], insulin resistance, age-related neurodegenerative diseases [3], and human aging [4]. Infertility represents a significant clinical problem affecting approximately 15% of couples worldwide. To date, over 200 mouse models exhibiting reproductive defects have been described, yet none directly involve mitochondrial respiratory proteins [5].

Mitochondrial inner membrane peptidase (IMP) is a complex in the mitochondrial inner membrane that cleaves the intermembrane space-sorting signals from the precursor or intermediate polypeptides after they reach the inner membrane or the intermembrane space. Yeast IMP consists of inner membrane peptidase 1 (Imp1p) and inner membrane peptidase 2 (Imp2p), which have nonoverlapping substrate specificity [6, 7], and a third subunit, Som1p, which has no peptidase activity [8]. Cytochrome c1 (Cyc1) is the substrate for yeast Imp2p [6], and mitochondrial glycerol phosphate dehydrogenase 2 (Gut2p), cytochrome b2, cytochrome c oxidase subunit II (CoxII), and NADH-cytochrome b5 reductase are substrates for yeast Imp1p [7, 9]. Deletion of Imp1 in yeast causes respiratory deficiency such that the cells cannot grow on glycerol medium, whereas deletion of Imp2 does not, although it affects the processing of Cyc1 signal peptide. Mammalian genomes encode Imp1p and Imp2p homologues, which are Imp1 inner mitochondrial membrane peptidase-like (IMMP1L) and Imp2 inner mitochondrial membrane peptidase-like (IMMP2L), respectively. At present it is not known what substrates IMMP1L and IMMP2L have or what effects IMP complex deficiency could have in mammalian systems.

Human patients with mutations in mitochondrial respiratory components important for normal mitochondrial function usually exhibit a very severe syndrome or die before adulthood [1]. To date, efforts toward targeting genes involved in mitochondrial respiration in mice, such as the mouse Coq7 gene, a gene involved in synthesis of ubiquinone [10], have often resulted in embryonic lethality. Thus, mammalian animal models that have defined mitochondrial dysfunction and are suitable for study of the mitochondrial roles in aging, neurodegeneration, and reproduction are not readily available.

Here we report the generation and characterization of a mouse mutant with a mutation in the inner mitochondrial membrane peptidase 2-like (Immp2l) gene, which manifested phenotypes of impaired gametogenesis and erectile dysfunction (ED). We show that deficiency of IMMP2L protein affects the signal peptide sequence processing of mitochondrial proteins cytochrome c1 (CYC1) and glycerol-3-phosphate dehydrogenase (GPD2). Mitochondria from mutant mice manifested hyperpolarization, higher than normal superoxide ion generation, and higher levels of ATP. The mutant mice developed to adulthood but showed a lesser ability to gain weight. Homozygous mutant females were infertile due to defects in folliculogenesis and ovulation, whereas mutant males were severely subfertile, manifesting ED and an age-related defect in spermatogenesis. These data suggest that the high superoxide ion levels lead to a decrease in bioavailability of nitric oxide (NO) and an increase in ROS stress, which underlies these reproductive defects.

MATERIALS AND METHODS

Animal Housing

Mice were housed in the animal facilities of Baylor College of Medicine and Wake Forest University Health Sciences. Experiments were conducted in accordance with the National Research Council publication Guide for Care and Use of Laboratory Animals.

Generation of Transgenic Mice

The transgenic vector was constructed by replacing the EcoRI-ClaI fragment of the pgk-neo cassette from the retroviral vector MSCVneoEB described by Hawley et al. [11] with an EcoRI-ClaI Tyrosinase minigene from pTyBS [12]. The resulted plasmid was linearized by NheI, and the 5.5 kb fragment containing the LTR-Tyr expression cassette was recovered from an agarose gel. The DNA was resuspended in injection buffer (5 mM Tris/0.1 mM EDTA, pH 7.4) at the concentration of 4 ng/µl and used for pronuclear injections. Inbred albino FVB/N fertilized eggs were used for the injection. Because tyrosinase, which is mutated in FVB/N, is an essential enzyme for pigmentation, expression of the transgene in the genome will rescue the albinism of FVB/N, resulting in a pigmented mouse. Pigmentation can then be used as a marker for the presence of the transgene and to differentiate heterozygous from homozygous mice on the basis of depth of pigmentation. Pigmented founder lines harboring the transgene were bred to homozygosity (judged by darker coat color) by intercrossing the heterozygous transgenic males and females. To check the fertility, we then mated homozygous transgenic mice to wild-type FVB/N mice. Fertile mice were discarded, and infertile homozygotes, such as OVE 979, were kept for further investigation.

Fluorescence In Situ Hybridization

We prepared chromosome spreads from transgenic mouse spleen cells according to standard protocols [13]. Digoxygenin-labeled (Roche) tyrosinase cDNA was used to probe G-banded metaphase spreads. Digoxygenin-labeled DNA was detected with a fluorescein isothiocyanate-conjugated anti-digoxygenin antibody (Roche). The spreads were counterstained with 0.2 µg/ml propidium iodide, and images were captured using a camera connected to the microscope.

Comparative Genomic Hybridization

Genomic DNA from normal FVB/N mice and homozygous mutant mice were labeled with cy5 and cy3, respectively. An equal amount of cy3- and cy5-labeled DNA was mixed and hybridized to a genomic DNA microarray containing mouse chromosome 12 probes (probes designed according to mouse genome assembly MM7 of UCSC Genome Browser, NimbleGen Systems). DNA labeling, hybridization, data acquisition, and analysis were performed by NimbleGen Systems on a fee-for-service basis.

RT-PCR

Total RNA was extracted from mouse ear biopsies, using an RNeasy Protect Mini Kit (Qiagen). First strand cDNA was synthesized using Maloney Murine Leukemia Virus reverse transcriptase as instructed by the manufacturer (Invitrogen). The following primers were used to detect the expression of target cDNA: IMP2LF (cagaattcaccatggcacagtcacaaagctg) and IMP2LR (caggatcctttctccaccagtctggagtg) for the detection of full-length Immp2l cDNA, IMP2LF (cagaattcaccatggcacagtcacaaagctg) and IMM2LM (actatcaaaactgtgtccatg) for truncated Immp2l cDNA, Lrrn3F (gcaagaagacagccatgtga) and Lrrn3R (ggcccttaaggattccagtc) for Lrrn3, Dock4F (ctggacagtgggaaagaagc) and Dock4R (tccttgcgtacaggttcctc) for Dock4, and DnajF (ttaatcctggcctccaaaag) and DnajR (atccgcctccaaaagaaaac) for Dnajb9. The thermal cycle parameters were: 94°C 4 min, followed by 35 cycles of 94°C 30 sec, 55°C 30 sec, 72°C 1 min.

Mitochondrial Respiratory Complex Activity Assay

Activities of mitochondrial respiratory complex I, II, I+III, II+III, and IV of the testis and muscle tissues were assayed by The Robert Guthrie Biochemical Molecular Genetics Laboratories of the State University of New York at Buffalo, directed by Dr. G.D. Vladutiu.

Isolation of Mitochondria From the Testis and Brain Tissues

Mitochondria were isolated using a discontinuous Percoll gradient protocol as described [14]. All the instruments and buffers were kept ice-cold during the procedure. Mutant mice and their normal littermates (3–4 mo old) were killed by overdoses of CO2. The brains, without the cerebellum, and the testes were removed and weighed. The tissues were homogenized in mitochondrial isolation buffer (MIB; sucrose, 250 mmol/L; K+-EDTA, 0.5 mmol/L; Tris–HCl, pH 7.4, 10 mmol/L; and bovine serum albumin, 1%) using Dounce homogenizers and glass pestles (Kontes Glass). The homogenate was centrifuged for 3 min at 500 x g, and then the supernatant was collected and resuspended in equal amounts of 24% Percoll (Sigma-Aldrich) in MIB. This suspension was layered onto a discontinuous Percoll gradient (24% and 40% in MIB). The gradient was centrifuged for 5 min at 28 000 x g, and the layer between the 24% and 40% Percoll suspensions containing the purified mitochondria was collected. Ten milliliters of MIB was added to the suspension, and the mitochondria were pelleted by centrifugation at 15 000 x g and 4°C for 12 min. The pellet was washed once more with 1 ml MIB and centrifuged for 12 min at 13 400 x g. Protein content was determined by a detergent-compatible protein assay kit (Bio-Rad).

SDS–PAGE and Western Blot Analysis

Isolated mitochondrial protein was added 1:1 to 2x Laemmli buffer (2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.002% bromphenol blue, 0.0625 M Tris HCl). Freshly dissected tissues were homogenized directly in 1x Laemmli buffer and used immediately to minimize protease activity. The protein samples were heated at 95°C for 5 min before being loaded on a Precast SDS-PAGE gel (Bio-Rad). Western blot and SDS–PAGE assays were carried out according to established protocol [15]. Antibodies to mouse CYC1 (1:1000), GPD2 (1:500), and DIABLO (1:500) were purchased from ProteinTech Group, Abnova, and Alexis Biochemicals, respectively. A rabbit polyclonal antibody (a kind gift from Dr. Xiaodong Wang), 1:400 was also used in the experiments. Horseradish peroxidase-conjugated secondary antibodies were purchased from Pierce. Chemiluminescent reagents from Pierce were used to visualize the protein with the LAS-3000 system from Fujifilm.

Superoxide Generation Assay

Superoxide generation was assayed as described [14]. Hydroethidine (5 mmol/L in dimethyl sulfoxide, Invitrogen) stock solution was kept at –80°C. Immediately before use, the dye was diluted with MIB to a concentration of 10 µmol/L. We added 100 µL of each mitochondria sample and 100 µL of diluted hydroethidine to 96-well plates. Eight wells were allocated for each sample to obtain the average and the standard deviation. The oxidation of hydroethidine to ethidium was monitored fluorometrically with a FLUOstar OPTIMA microplate reader (BMG Labtech) with excitation at 470 nm and emission at 590 nm. The measurement was performed for 30 min with intervals of 1 min between each reading. We used MIB without mitochondria to measure the background fluorescence. Fluorescent intensity after subtraction of background was plotted against time to obtain the slope of superoxide generation. The reading was controlled by mitochondrial protein concentration.

ATP Assay

Mitochondria ATP levels were measured using the glow-type CellTiter-Glo Luminescent Assay Kit (Promega) as directed by the the manufacturer. We loaded 50 µL of mitochondria samples into opaque-walled, 96-well plates, and equal volumes of CellTiter-Glo were added to each well. Eight wells were allocated for each sample to obtain the average and the standard deviation. The plates were incubated at room temperature (21°C) for 10 min to stabilize the luminescent signal. Luminescence was measured with a FLUOstar OPTIMA microplate reader.

Analysis of Mitochondrial Membrane Potential

The mitochondrial membrane potential (MMP) was analyzed using the membrane potential-sensitive dye tetramethylrhodamine ethyl ester (TMRE) (Molecular Probes) as described [14]. TMRE was prepared as a 1 mg/mL stock solution in ethanol. Equal numbers of mitochondria (determined by protein concentration) from mutant and normal mice were loaded in the dark with TMRE at a final concentration of 0.5 µmol/L at 4°C. After being loaded, the mitochondria were rinsed three times with MIB buffer and then were resuspended in 900 µL MIB. We added 100 µL of the suspension to 96-well plates, and eight wells for each sample were loaded. TMRE-fluorescence was measured with the same microplate reader used for superoxide measurements ({lambda}ex = 510 nm, {lambda}em = 590 nm). The average and the standard deviation were obtained for each sample.

TUNEL Assay

The testis from 7-mo-old mutant and control males were fixed in Bouin fixative and sections of 8 µm were obtained. Terminal transferase dUTP nick end labeling and TUNEL enzyme (Roche) were used for the assay as instructed by the manufacturer.

Mating Behavior Study of Mature Mutant Males

Mating behavior tests were performed during the dark phase of a 12L:12D cycle starting 2 h after the beginning of the dark cycle. Behavioral test sessions were observed by persons unaware of the genotypes of the mice. Six mutant and six normal males ~2–3 mo old were caged individually for at least 7 days before the assay. FVB/N females were made sexually receptive by intraperitoneal injection of 5 IU eCG, followed by an intraperitoneal injection of 5 IU hCG 48 h after the eCG injection. Mating tests were conducted under red light 6 h after the hCG injection. A sexually receptive female FVB/N mouse was brought to the cage of the test male, and the following behaviors were recorded during the first 30 min: 1) the number of mounts, 2) the latency to mount, and 3) the number of intromissions. After their mating behavior was observed, the male and female were caged together until the next light cycle, when the females were checked for the presence of copulatory plugs. The females were then housed separately from the males to prevent subsequent insemination. Pregnancy of the females was followed up. Each male was assayed twice, with an interval of 1 week between assays.

Corpus Cavernosum Organ Bath

The tunica albuginea was carefully opened from its proximal extremity of the corpus cavernosum (CC) toward the penile shaft, and the erectile tissue within the CC was microsurgically excised. One preparation (0.3 x 0.3 x 3 mm) was obtained from each CC. All preparations were used immediately after removal. Strip preparations were prepared and mounted in thermostatically controlled organ baths (6 ml; 37°C) containing Krebs solution bubbled with a mixture of 95% O2 and 5% CO2 (pH 7.4). Isometric tension was recorded, and electrical field stimulation was performed with two platinum electrodes placed in parallel to the sides of the strips in the organ baths. The nerves of the preparations were stimulated by means of an S48 stimulator (Astro-Med), delivering single square-wave pulses at 40 V with a duration of 1 millisecond.

During an equilibration period of 45 min, tension was adjusted until mean stable tensions of 0.8 mN (milli-Newton) were obtained. To verify the contractibility of the preparations, we added a KCl solution (124 mM) to the organ baths at the end of the equilibration period. The phenylephrine (PE) concentration used (1 µM) corresponded to the approximate 80% of maximal contraction value and produced stable and reproducible contractions. The effects of carbachol were investigated in PE-contracted preparations.

Relaxant responses to transmural stimulation of nerves were investigated in PE-contracted preparations. The degree of relaxation was expressed as percentage of the PE-induced contraction. Effects of electrical field stimulation were then investigated as described earlier. A Krebs solution of the following composition was used (in mM): NaCl 119, KCl 4.6, CaCl2 1.5, MgCl2 1.2, NaHCO3 15, NaH2PO4 1.2, and glucose 5.5. In the high KCl solution (60 mM), the NaCl in the normal Krebs solution was replaced by equimolar amounts of KCl.

Statistical Analysis

Student unpaired two-tailed t test and analysis of variance were used for statistical comparison. A probability of P < 0.05 was accepted as significant. When appropriate, results are given as mean values ± SEM.

RESULTS

Generation of a Mutant Mouse With Reproductive Defects by Transgenic Insertional Mutagenesis

We used a random transgenic insertional mutagenesis strategy to generate molecularly defined mouse mutants with reproductive failure. For this purpose, a 5.5 kb NheI fragment containing the LTR-Tyr expression cassette was used for standard pronuclear microinjection of albino FVB/N fertilized eggs. The pigmented founder transgenic lines were bred to homozygosity and mated to wild-type mice to check their fertility. Line OVE 979 was found to have severely decreased fertility in both sexes. Fluorescent in situ hybridization using the transgene as a probe demonstrated that OVE 979 carried a single integration site on mouse chromosome 12C1 (Fig. 1A). High-resolution, oligo-array based, comparative genomic hybridization (performed by Nimblegen Systems) identified a 50 kb deletion on chromosome 12, within the sixth intron of the inner mitochondrial membrane peptidase 2-like gene, (Immp2l), associated with the transgene insertion (Fig. 1, B and C).


Figure 01
View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 1. Genomic lesion in mutant mice. A) FISH mapping of the integration site of the transgene shows a single transgene integration site (*) on chromosome 12C1. B) Oligo-array based comparative genome hybridization located a 50 kb deletion on mouse chromosome (Chr.) 12. C) The 50 kb deletion was located within the sixth intron of Immp2l. In addition to Immp2l, other genes near the deletion (Dock4, Lrrn3, and Dnajb9) are also listed. Arrows indicate the primers used in RT-PCR experiments shown in D and E. Probes were designed according to mouse genome assembly MM7 (assembled in May 2005) of UCSC Genome Browser. D) Expression of Immp2l in the mutant mouse. Full length Immp2l (exon 1–exon 7, labeled E1–E7) expression was absent, but a truncated mRNA derived from the first six exons (exon 1–exon 6, labeled E1–E6) was present. M, DNA ladder (100, 200, 300, 400, and 500 bp, starting from the bottom); *, primer band. E) Normal expression of Lrrn3, Dock4, and Dnajb9 in the mutant. RNA was extracted from tail biopsies of homozygous mutant mice (–/–) and age- and sex-matched wild type littermates (+/+). RT+, with reverse transcriptase; RT–, without reverse transcriptase.

Expression of Immp2l is Disrupted in the Mutant Mice

Full-length Immp2l mRNA could not be detected in the mutant mice by RT-PCR, whereas a truncated form containing the first six exons was expressed (Fig. 1D). This suggests that expression of full-length Immp2l is disrupted by the transgene insertion through a premature transcription termination or a gene trapping event. Any potential protein product from the truncated mRNA will therefore lack the C-terminal 40 amino acids, which in yeast is essential for the activity and stability of Imp2 [9]. The expression of known genes adjacent to both ends of the deleted region, including Dock4, Lrrn3 (itself within exon 4 of Immp2l), and Dnajb9, was not affected (Fig. 1E). This mutant was designated as Immp2lTg(Tyr)979Ove.

CYC1 and GPD2 Signal Peptide Processing is Affected in Immp2lTg(Tyr)979Ove Mice

The IMMP2L protein is one of two catalytic subunits of the mitochondrial IMP complex. In yeast this complex cleaves the intermembrane space-sorting signals from mitochondrial proteins after they reach the inner membrane or the intermembrane space. To determine whether IMMP2L activity is affected in homozygous Immp2lTg(Tyr)979Ove mice, we analyzed the sizes of possible IMMP2L substrates in Immp2lTg(Tyr)979Ove mice. Because yeast Cyc1 is the substrate of Imp2p (the yeast homologue of mammalian IMMP2L), and mouse CYC1 can be processed by mouse IMMP2L when assayed in yeast [6, 15], we compared the size of CYC1 protein in Immp2lTg(Tyr)979Ove mice and their normal littermates. The mouse CYC1 precursor protein has to be processed sequentially by two peptidases: mitochondrial processing peptidase and IMP, after which it becomes a mature protein of 27.3 kDa. We found that CYC1 in homozygous Immp2lTg(Tyr)979Ove mice was 32.5 kDa, larger than that found in controls (Fig. 2A). This size was smaller than the predicted molecular weight of the CYC1 precursor (35.3 kDa) but larger than that of CYC1 mature protein (27.3 kDa). This product probably represents the intermediate processed form of CYC1. CYC1 protein from all tissues tested showed this increased size (Fig. 2B), which indicated that IMMP2L deficiency affected all tissues, consistent with its ubiquitous expression.


Figure 02
View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 2. Impaired processing of IMMP2L substrates in mutant mice. A) Molecular weight of CYC1 from mutant (–/–) mice was higher than that of normal (+/–, +/+) controls. Liver mitochondrial protein was analyzed using anti-CYC1 antibody. M, Molecular weight marker. B) CYC1 from various tissues of mutant mice was larger than that of control mice. C) GPD2 from mutant mice was larger than that of controls. Mitochondrial proteins from brown fat were separated on 7.5% Precast gel and detected with anti-GPD2 antibody. In mutant mice, some of the protein seemed to be processed, which turned out to be the effect of protease activity during and after preparation of the samples. D) Brown fat tissue was lysed directly in SDS sample buffer and run immediately; no protein was processed. E) Normal size of DIABLO in mutant mice. Mitochondrial proteins prepared from the testes of different genotypes were separated on 8%–16% Precast gradient gel and detected with a monoclonal anti-DIABLO antibody or a rabbit polyclonal antibody.

Yeast Gut2p is a substrate for Imp1p, whereas its mammalian homologue, GPD2, has been suggested as a substrate for IMMP2L [9, 15]. The mouse GPD2 precursor contains 727 amino acids, and the first 42 amino acids serve as the presequence [16]. Analysis of the processing of yeast Gut2p, and of mammalian GPD2 in yeast, suggested that they were processed in one step by IMP [9, 15]. To examine whether the processing of GPD2 in Immp2lTg(Tyr)979Ove mice is affected, we analyzed the molecular weight of GPD2 in mutant mice and showed it to be greater than that in normal littermates (Fig. 2C). We noticed that a proportion of the GPD2 protein from the mutant mice seemed to be processed to some extent; this turned out to be the effect of protease activity during and after preparation of the samples. To reduce the processing of the precursor proteins by soluble protease activity after lysis of the tissues, we lysed fresh brown fat tissue directly with Laemmli buffer and loaded it immediately. No sign of processing was found (Fig. 2D). A similar phenomenon was found with CYC1. In tissues such as kidney, heart, intestine, brown fat, and brain, CYC1 precursors were also found to be gradually processed by soluble protease activity resistant to Laemmli buffer (data not shown). Because this activity was found only in some of the tissues, whereas IMMP2L is expressed in all the tissues, truncated IMMP2L protein in the mutants is unlikely to be responsible for the protease activity. In the heterozygous transgenic mouse (+/–), there was also some GPD2 protein unprocessed (Fig. 2C), indicating that GPD2 processing in the heterozygotes was also affected to some degree. No unprocessed CYC1 was found from heterozygous transgenic mice (Fig. 2A). The abnormal size of CYC1 and GPD2 in mutant mice is consistent with the loss of activity of IMMP2L affecting the cleavage of the intermembrane space-sorting signal.

It has been shown in yeast that Imp2p is necessary for the stability and thus the function of Imp1p [6]. It is not known whether the same situation applies to the mammalian IMP complex. Among known yeast Imp1p substrates, cytochrome b2 lacks a mammalian ortholog; CoxII and NADH-cytochrome b5 reductase have mammalian orthologs, but they appear to lack a typical cleavable signal peptide sequence [17]. Mammalian DIABLO/SMAC (second mitochondria-derived activator of caspase) has been shown to be a substrate for IMP, and IMMP1L is suggested as the active site [18]. We thus compared the sizes of DIABLO in mutant and normal mice and found that they were the same size (Fig. 2E), suggesting that IMMP2L deficiency is specific and does not affect the processing of IMMP1L substrates.

Perturbed Mitochondrial Function in Homozygous Immp2lTg(Tyr)979Ove Mice

The mutant mice with IMMP2L deficiency were viable and developed normally, except for an approximately 10% less body weight before adulthood compared to normal controls (data not shown). This lower body weight was no longer significant after the age of ~4–5 mo. Gpd2 null mice have also been reported to show less body weight [19, 20]. This might explain why Immp2lTg(Tyr)979Ove mice show less body weight, because we found that the processing of GPD2 in the mutant is affected. However, Gpd2 null mice do not manifest reproductive phenotypes similar to those of the Immp2lTg(Tyr)979Ove mice, thus the inability to process GPD2, a protein involved in the NADH shuttle system, cannot account for the reproductive defects seen in homozygous Immp2lTg(Tyr)979Ove mice.

CYC1 is a component of the mitochondrial respiratory chain complex III. To check whether the abnormal processing of CYC1 and/or other potential IMMP2L substrates to be identified affects the respiratory function of mitochondria, we assayed the activities of mitochondrial respiratory complexes I, II, I+III, II+III, and IV of the testis and muscle tissues. All the activities were found to be in the range of the respective human reference values (Table 1). A side by side comparison of the activities between the mutant and the normal control revealed a marginal but significant I and I+III activity difference in the testis lysate. The ratio of activities after control by the activity of citrate synthase also revealed a slightly lower activity of mitochondrial respiratory complex I+III in the mutant testis (Fig. 3A). The physiological significance of the marginal difference is not clear.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 1. Enzymatic activities of mitochondrial respiratory complexes (µmol/min per g tissue).


Figure 03
View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 3. Perturbed mitochondrial function in mutant mice. A) Comparison of the respiratory complex enzymatic activities from mutant and control tissues. The activities of the complexes were controlled by the activity of citrate synthase. Respective values from tissues of control mice were regarded as 1. Values were obtained from three independent assays. B) Mitochondria isolated from tissues of mutant mice were hyperpolarized. C) Mitochondria isolated from tissues of mutant mice showed higher levels of ATP. D) Cells from mutant mice showed higher levels of ATP. Mitochondria isolated from mutant testis (E), mutant brain (F), and purified mutant sperm (G), all generated superoxide at a higher than normal rate. Error bars in B–G indicate mean ± SEM.

To check the possible effects of IMMP2L deficiency on the maintenance of MMP and generation of ATP, we compared the MMP and ATP levels of isolated mitochondria from normal and homozygous Immp2lTg(Tyr)979Ove mice. We found that mitochondria isolated from the testis and brain tissues of mutant mice were hyperpolarized (Fig. 3B). They also showed higher ATP levels compared to mitochondria isolated from normal mice (Fig. 3C). Higher levels of ATP were also found in spermatozoa and splenic lymphocytes from mutant mice (Fig. 3D). Thus, energy deficiency is unlikely to be the cause for the infertility observed in mutant mice.

CYC1 is a component of mitochondrial respiratory chain complex III which, together with complex I, is the major site of superoxide generation in the mitochondrion [21]. We therefore measured superoxide levels in mutant and normal mice to determine if Immp2l disruption could lead to a change in ROS levels. We found a significantly elevated rate of superoxide ion generation in mitochondria isolated from mutant testes (Fig. 3E), brain (Fig. 3F), and purified sperm (Fig. 3G). Apart from the difference in mitochondrial MMP, ATP, and superoxide ion generation, IMMP2L deficiency did not affect the number/volume of mitochondria as revealed by flow cytometry analysis of the lymphocytes from the spleens of mutant and normal mice, stained with a mitochondrial-specific dye, MitoTracker Green (Invitrogen) (data not shown). Splenic lymphocytes are easily obtained and have been used for similar analysis with Tyk2–/– mice [22].

Female Mutant Mice Are Infertile Due to Defects in Folliculogenesis and Ovulation

Homozygous Immp2lTg(Tyr)979Ove females were infertile. Histological analysis of ovaries from 3-wk-old mutant females, when follicle development does not proceed beyond the preantral/early antral stage, did not reveal any abnormalities, indicating that preantral follicle stage development was normal (data not shown). When ovaries of adult mutant females were analyzed, more preantral follicles and fewer antral follicles were observed in mutant mice (Fig. 4A, arrowed). Degenerating follicles were also readily found in mutant ovaries (Fig. 4B, arrowed) together with marked luteinization (Fig. 4B, asterisk). Superovulation of 3- to 4-wk-old females recovered an average of 38 oocytes from each control female, whereas only an average of 1.5 eggs could be obtained from each mutant female (Fig. 4C). An examination of the superovulated ovaries revealed an abundance of luteinized follicles and trapped oocytes (Fig. 4C, arrowed). These data indicate that there are intraovarian defects in preovulatory follicles that could not be rescued by ovulatory doses of gonadotropins. To determine whether oocytes from mutant females have defects in maturation, germinal vesicle breakdown (GVBD), a process associated with the reentry of oocytes into meiosis, was examined in isolated mutant oocytes. Although over 80% of oocytes from control females showed GVBD, less than 40% of oocytes from mutant females finished GVBD (Fig. 4D).


Figure 04
View larger version (68K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 4. Impaired folliculogenesis in mutant females. A) Ovary sections of normal 9-wk-old control (+/–) and mutant (–/–) females were stained with hematoxylin and eosin. Note that there are more preantral follicles (arrowed) and fewer antral follicles in the mutant ovary. Bars = 200 µm. B) Mutant (–/–) ovaries stained with periodic acid-Schiff (PAS). Note the abundance of degenerating oocytes (arrow), residual substance from trapped oocytes (double arrows), and luteinized structures (*). C) Mutant females had a low ovulation rate. Left panel: 21-day-old females were superovulated and the number of MII oocytes recovered from the ampulla was scored (*, P < 0.05). Right panel: superovulated ovary sections were stained with PAS. Note the abundance of luteinized follicles and trapped oocytes (arrows) in the mutant (–/–) ovaries. D) Mutant oocytes have defects in maturation. Left panel: 3-wk-old females were injected with eCG, germinal vesicle oocytes were recovered by ovarian puncture, and GVBD was assayed (*, P < 0.05). Right panel: representative micrographs showing GVBD in control oocytes (+/–) and no GVBD in a mutant (–/–) oocyte stained with 4',6-diamidino-2-phenylindole. Magnification x40. Error bars in C and D indicate mean ± SEM.

Impaired Spermatogenesis and Erectile Dysfunction in Homozygous Immp2lTg(Tyr)979Ove Males

Mutant males were severely subfertile. Virtually all males failed to sire pups after mating for more than 3 mo with proven fertile females. Testis histology showed that spermatogenesis in 2- to 3-mo-old mutant males was normal, with all developmental stages being present and with normal sperm numbers in the tubules and epididymis (Fig. 5A, left panel). In contrast, in 7-mo-old mutant males (Fig. 5A, right panel), seminiferous tubules showed a marked heterogeneous pattern of disorganization, vacuolation, and reduced germ cell numbers. TUNEL assays on testes of 7-mo-old mutant males (Fig. 5B, right panel) showed that the rate of germ cell apoptosis was significantly higher than in normal littermate controls (Fig. 5B, left panel). However, this impaired spermatogenesis was age-dependant and cannot explain the infertility seen in 2- to 3-mo-old mutant males.


Figure 05
View larger version (53K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 5. Age-related impaired spermatogenesis and decreased relaxant response in CC of mutant males. A) Histological analysis of testis sections of mutant (–/–) males at 3 mo (left panel) shows normal spermatogenesis. At 7 mo (right panel), tubules in mutant testis (–/–) are vacuolated, and spermatogenesis is disorganized with only approximately 10% of germ cells remaining. Bars = 100 µm. B) TUNEL assay revealed more cells undergoing apoptosis in mutant testis despite mutant seminiferous tubules having fewer germ cells. Testis sections from 7-mo-old mutant males (right panel) and age-matched control males (left panel) were processed for TUNEL assay using TUNEL labeling and TUNEL enzyme from Roche. Apoptotic cells were stained green. Nuclei were stained red by propidium iodide. C) Decreased relaxation of CC from mutant mice to carbachol stimulation of NO release. Strips were precontracted with 3 x 10–6 M PE and relaxation was induced with various concentrations of carbachol. *, P < 0.05. Four control and six mutant males were used for the experiments. D) Decreased relaxation of PE-contracted CC strips from mutant males upon electrical field stimulation. Strips were precontracted with 3 x 10–6 M PE and relaxation was induced with various frequencies of electrical field stimulation. *, P < 0.05. Error bars in C and D indicate mean ± SEM.

The external genitalia of the mutant males did not show abnormalities in terms of overall structure or morphology. Similarly, epididymal sperm from 2- to 3-mo-old mutant males exhibited normal number, morphology, and motility (data not shown). We could not find copulatory plugs in normal mature females mated to adult mutant males. To test whether mutant males have decreased sexual drive so that they do not mate, mating behavior tests were performed with hormonally induced receptive females. As shown in Table 2, no difference in mount latency or number of mounts was found, indicating that mutant males showed normal sexual drive.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 2. Mutant males showed normal sexual desire in mating tests.

Although successful intromissions were readily observed in control males, they were seldom observed in mutant males, indicating a sexual dysfunction in mutant males. We kept the mating pairs together overnight after the mating test and checked for the presence of a copulatory plug the following morning. All females mated with normal males had plugs, whereas only 2 out of 12 females mated with mutant males had a copulatory plug. These two females subsequently became pregnant and gave birth to healthy pups, all heterozygotes as judged by coat color. Two different males impregnated the two females; each of the two males failed to impregnate receptive females in one of the two tests. These observations strongly indicate a mating problem with the mutant males while suggesting normal sperm function of mutant males. To date, mutant males have only occasionally impregnated receptive females injected with hormones.

To test whether the infertility/subfertility of mature mutant males could be due to ED, we isolated CC tissue from mutant and normal mice and analyzed its ability to contract in vitro. The endothelial and neurogenic components of smooth muscle relaxation were tested by addition of carbachol and electrical field stimulation as described previously [23]. Spontaneous contractile activity was not observed in either normal or mutant CC preparations. Tissue from mutant and control males had similar contractile capacity as tested by PE (10–6 M). When the tissues were tested for the ability to relax by addition of carbachol, a stimulator of NO release by endothelial cells, strips from mutant males showed a significantly decreased response (Fig. 5C). Furthermore, electrical field stimulation of the nerves innervating the smooth muscle cells of the CC strips at 32 Hz revealed a significant decrease in response in mutant males (Fig. 5D). Taken together, these data show that the CC of mutant males exhibited impaired responses to stimuli that induce the release of NO, consistent with their having severe ED.

We postulate that the low bioavailability of NO due to the fast reaction of superoxide with NO might be the cause of the ED phenotype. We assayed the total amount of nitrate and nitrite in the penises of the mutants and the controls using the improved Griess method and did not find a significant difference (data not shown), which suggested that the production of NO is normal. This is in agreement with our proposal that ED might be caused by the low bioavailability of NO due to inactivation by high levels of mitochondrial superoxide, although the production of NO might be normal. A direct measurement of the NO concentration in the CC smooth muscle would provide an answer to this issue. Efforts are being taken toward this goal, although the need to distinguish between NO and OONO–, the reaction product of NO, and superoxide in this case makes such a measurement challenging.

DISCUSSION

We show here that IMMP2L deficiency in mice affected the size of CYC1 and GPD2. The abnormal sizes of CYC1 and GPD2 in Immp2lTg(Tyr)979Ove mice are most likely the result of the loss of activity of IMMP2L. Mammalian IMMP2L has been shown to process CYC1 and GPD2 in yeast cells [15]. Other posttranslational protein modifications are unlikely the cause of the increased molecular weight of the two proteins, because no evidence suggests that IMMP2L is involved in protein modification processes other than signal peptide cleavage. Our data provide the first in vivo evidence that CYC1 and GPD2 are substrates of IMMP2L, one of the subunits of the mammalian mitochondrial IMP. Yeast Imp2 is necessary for the activity and stability of Imp2 [6]. We show that IMMP2L deficiency does not affect the size of DIABLO/SMAC, a protein suggested to be a substrate of IMMP1L [18], indicating that in the mammalian IMP complex, the activity and stability of IMMP1L does not depend on the presence of IMMP2L. At present, it is not known whether IMMP2L has other substrates, and the IMMP2L-deficient mouse will be useful in searching for other potential IMMP2L substrates. Gpd2 null mice have been generated, but they do not show fertility defects found in Immp2lTg(Tyr)979Ove mice [19, 20]. This suggests that the abnormal processing of CYC1 and/or other IMMP2L substrates causes the fertility defects in mutant mice.

We found that mitochondria from Immp2lTg(Tyr)979Ove mice showed higher levels of MMP, ATP, and superoxide ion generation, which could be the result of incomplete processing of substrate proteins such as CYC1, GPD2, and/or other target proteins to be identified (Fig. 3, A and B). CYC1 is a component of mitochondrial respiratory chain complex III, one of the major sites of proton pump and superoxide ion generation. A functional perturbation of the respiratory chain due to the incomplete processing of IMMP2L substrates seems to have resulted in a hyperactive mitochondrion. Higher levels of MMP, ATP, and superoxide ion generation could be the result of a high respiration rate. Mitochondrial membrane potentials provide the energy for ATP synthesis; a high ATP level is consistent with the high MMP observed in mutant mice. Higher superoxide generation could be the result of high electron input and subsequent leakage to oxygen. More experiments on mitochondrial respiration are needed to gain a better understanding of why mitochondria from mutant mice showed higher levels of MMP, ATP, and superoxide ion generation. Although it is not clear whether abnormal levels of MMP and ATP play any role in the fertility defects in mutant mice, we believe that higher superoxide ion generation by the mitochondria from mutant mice is the most likely cause of the reproductive defects we see in mutant mice.

Superoxide has been shown to inactivate NO by transforming it to peroxynitrite several times faster than the dismutation of superoxide by superoxide dismutase [24–26]. The excessive superoxide generated in mutant mitochondria could therefore decrease the bioavailability of NO. In the cardiovascular field, it has long been recognized that superoxide anions and NO are chemical antagonists of each other, and in several models of vascular diseases, impairment of endothelium-dependent relaxations and promotion of endothelium-dependent contractions has been ascribed to increased production of superoxide anions [27]. Mice deficient in endothelial cell nitric oxide synthase or neuronal nitric oxide synthase show impaired folliculogenesis, ovulation, oocyte meiotic maturation, and oocyte survival [28–30]. Thus, low bioavailability of NO is consistent with the phenotype seen in Immp2lTg(Tyr)979Ove ovaries. In males, smooth muscle NO is a key mediator of erectile function [31, 32], and endothelial cell nitric oxide synthase- or neuronal nitric oxide synthase-deficient mice manifest impaired erectile function [33, 34]. Thus, ED observed in mutant males could be the result of high generation of superoxide. It has been observed in blood vessels that high superoxide generation impairs the relaxation of smooth muscle [27].

With regard to the age-related spermatogenic degeneration seen in 7-mo-old mutant males, we suggest that germ cell apoptosis was mediated by ROS from elevated superoxide generation. ROS has been shown to mediate apoptosis in various somatic cells, including T cells, embryonic cortical neurons, spinal neurons, and HL-60 cells [35–38]. ROS is also implicated in the apoptosis of testicular germ cells induced by heat and ischemia-reperfusion of the testis in animal models [39–42]. The product of superoxide dismutation, H2O2, has been shown to mediate intrinsic mitochondria-dependent apoptosis after the activation of SHC1 (p66), a regulator protein responding to cell stress [43]. Mammalian cells have a sophisticated ROS scavenger system [44]. It is reported that compared to the liver, rat testis expressed only 5% of the glutathione peroxidase activity and 2% of catalase activity [45]. Compared to somatic cells in the testis, such as Sertoli or peritubular cells, the testicular germ cells had lower glutathione peroxidase, glutathione reductase, and glutathione S-transferase activity [46]. This might explain why excessive apoptosis is found only in germ cells but not in Sertoli cells or peritubular testicular cells of old mutant mice. An interesting question, then, is why excessive apoptosis of germ cells happens only in aged mutant males but not in young mutant adults. Our explanation is that in young mutant males, the ROS scavenger system in the testis is able to keep ROS stress to a level that germ cell apoptosis cannot be triggered. In aged mutant males, either due to decreased ROS scavenger activities or a vicious cycle of further mitochondrial ROS generation or both, ROS levels reach a degree that apoptosis is triggered. Thus, Immp2lTg(Tyr)979Ove mice provide a good model for the study of mitochondrial ROS in germ cell apoptosis.

The risk of ED increases with age in normal men [47]. Although the exact reason is unknown, it has been shown that mitochondrial function declines with age [48]. Our finding suggesting that mitochondrial dysfunction, coupled with high mitochondrial superoxide generation, causes ED in mice might provide one of the explanations for such an observation.

Our data provide a novel link between mitochondrial dysfunction, gametogenesis, and ED. It has been estimated that 15%–57% of patients, especially those with type II diabetes, do not respond to phosphodiesterase inhibitors, the current drugs of choice for ED [49]. The novel finding that excessive superoxide ion generated by mitochondria might cause ED suggests that superoxide ion targeting agents might be effective in ED patients resistant to phosphodiesterase inhibitors. It has been suggested that mitochondrial dysfunction could be involved in aging and age-related neurodegeneration [3, 4]. The human IMMP2L gene has been mapped within the chromosomal region associated with Tourette syndrome [50, 51], and a mutation in IMMP2L has been reported in a patient with this syndrome [52]. The mutant mouse could also be useful for studying the role of IMMP2L in Tourette syndrome.

ACKNOWLEDGMENTS

We thank Areepan Sophonsritsuk, Zhan Wang, and Cooduvalli Shashikant for their help with the mouse mating behavior assay; Dr. Xiaodong Wang for providing us the anti-DIABLO/SMAC antibody; and Dr. George Christ for help with the tissue organ bath experiments.

FOOTNOTES

1Supported by Public Health Service grant U01HD043421 to C.E.B. from the National Institute of Child Health and Human Development. Back

Correspondence: 2FAX: 336 713 7290; e-mail: cbishop{at}wfubmc.edu

3Current address: Department of Medicine, Medical College of Georgia, Augusta, GA 30912. Back

Received: 4 October 2007.

First decision: 31 October 2007.

Accepted: 6 December 2007.

REFERENCES

  1. ; : Wallace DC. Mitochondrial diseases in man and mouse. Science 1999 2831482–1488[Abstract/Free Full Text]
  2. ; : Madamanchi NR and Runge MS. Mitochondrial dysfunction in atherosclerosis. Circ Res 2007 100460–473[Abstract/Free Full Text]
  3. ; : Mancuso M, Coppede F, Migliore L, Siciliano G, Murri L. Mitochondrial dysfunction, oxidative stress and neurodegeneration. J Alzheimer Dis 2006 1059–73
  4. ; : Sedensky MM and Morgan PG. Mitochondrial respiration and reactive oxygen species in mitochondrial aging mutants. Exp Gerontol 2006 41237–245[CrossRef][Medline]
  5. ; Matzuk MM and Lamb DJ. Genetic dissection of mammalian fertility pathways. Nat Cell Biol 2002 4(suppl):s41–s49[Medline]
  6. ; : Nunnari J, Fox TD, Walter P. A mitochondrial protease with two catalytic subunits of nonoverlapping specificities. Science 1993 2621997–2004[Abstract/Free Full Text]
  7. ; : Behrens M, Michaelis G, Pratje E. Mitochondrial inner membrane protease 1 of Saccharomyces cerevisiae shows sequence similarity to the Escherichia coli leader peptidase. Mol Gen Genet 1991 228167–176[CrossRef][Medline]
  8. ; : Jan PS, Esser K, Pratje E, Michaelis G. Som1, a third component of the yeast mitochondrial inner membrane peptidase complex that contains Imp1 and Imp2. Mol Gen Genet 2000 263483–491[CrossRef][Medline]
  9. ; : Esser K, Jan PS, Pratje E, Michaelis G. The mitochondrial IMP peptidase of yeast: functional analysis of domains and identification of Gut2 as a new natural substrate. Mol Genet Genomics 2004 271616–626[CrossRef][Medline]
  10. ; : Levavasseur F, Miyadera H, Sirois J, Tremblay ML, Kita K, Shoubridge E, Hekimi S. Ubiquinone is necessary for mouse embryonic development but is not essential for mitochondrial respiration. J Biol Chem 2001 27646160–46164[Abstract/Free Full Text]
  11. ; : Hawley RG, Lieu FH, Fong AZ, Hawley TS. Versatile retroviral vectors for potential use in gene therapy. Gene Ther 1994 1136–138[Medline]
  12. ; : Yokoyama T, Silversides DW, Waymire KG, Kwon BS, Takeuchi T, Overbeek PA. Conserved cysteine to serine mutation in tyrosinase is responsible for the classical albino mutation in laboratory mice. Nucleic Acids Res 1990 187293–7298[Abstract/Free Full Text]
  13. ; : Kallioniemi O, Kallioniemi A, Kurisu W, Thor A, Chen L, Smith HS, Waldman FM, Pinkel D, Gray JW. ERBB2 amplification in breast cancer analyzed by fluorescence in situ hybridization. Proc Natl Acad Sci U S A 1992 895321–5325[Abstract/Free Full Text]
  14. ; : Gaspar T, Kis B, Snipes JA, Lenzser G, Mayanagi K, Bari F, Busija DW. Neuronal preconditioning with the antianginal drug, bepridil. J Neurochem 2007 271318–1326
  15. ; : Luo W, Fang H, Green N. Substrate specificity of inner membrane peptidase in yeast mitochondria. Mol Genet Genomics 2006 275431–436[CrossRef][Medline]
  16. ; : Brown LJ, MacDonald MJ, Lehn DA, Moran SM. Sequence of rat mitochondrial glycerol-3-phosphate dehydrogenase cDNA. Evidence for EF-hand calcium-binding domains. J Biol Chem 1994 26914363–14366[Abstract/Free Full Text]
  17. ; : Borgese N, Aggujaro D, Carrera P, Pietrini G, Bassetti M. A role for N-myristoylation in protein targeting: NADH-cytochrome b5 reductase requires myristic acid for association with outer mitochondrial but not ER membranes. J Cell Biol 1996 1351501–1513[Abstract/Free Full Text]
  18. ; : Burri L, Strahm Y, Hawkins CJ, Gentle IE, Puryer MA, Verhagen A, Callus B, Vaux D, Lithgow T. Mature DIABLO/Smac is produced by the IMP protease complex on the mitochondrial inner membrane. Mol Biol Cell 2005 162926–2933[Abstract/Free Full Text]
  19. ; : Eto K, Tsubamoto Y, Terauchi Y, Sugiyama T, Kishimoto T, Takahashi N, Yamauchi N, Kubota N, Murayama S, Aizawa T, Akanuma Y, Aizawa S, Kasai H, Yazaki Y, Kadowaki T. Role of NADH shuttle system in glucose-induced activation of mitochondrial metabolism and insulin secretion. Science 1999 283981–985[Abstract/Free Full Text]
  20. ; : Brown LJ, Koza RA, Everett C, Reitman ML, Marshall L, Fahien LA, Kozak LP, MacDonald MJ. Normal thyroid thermogenesis but reduced viability and adiposity in mice lacking the mitochondrial glycerol phosphate dehydrogenase. J Biol Chem 2002 27732892–32898[Abstract/Free Full Text]
  21. ; : Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL, Lesnefsky EJ. Production of reactive oxygen species by mitochondria: central role of complex III. J Biol Chem 2003 27836027–36031[Abstract/Free Full Text]
  22. ; : Potla R, Koeck T, Wegrzyn J, Cherukuri S, Shimoda K, Baker DP, Wolfman J, Planchon SM, Esposito C, Hoit B, Dulak J, Wolfman A, Stuehr D, Larner AC. Tyk2 tyrosine kinase expression is required for the maintenance of mitochondrial respiration in primary pro-B lymphocytes. Mol Cell Biol 2006 268562–8571[Abstract/Free Full Text]
  23. ; : Hedlund P, Aszodi A, Pfeifer A, Alm P, Hofmann F, Ahmad M, Fassler R, Andersson KE. Erectile dysfunction in cyclic GMP-dependent kinase I-deficient mice. PNAS 2000 972349–2354[Abstract/Free Full Text]
  24. ; : Huie RE and Padmaja S. The reaction of NO with superoxide. Free Radic Res Commun 1993 18195–199[Medline]
  25. ; : Gryglewski RJ, Palmer RMJ, Moncada S. Superoxide anion is involved in the breakdown of endothelium-derived vascular relaxing factor. Nature 1986 320454–456[CrossRef][Medline]
  26. ; : Rubanyi GM and Vanhoutte PM. Superoxide anions and hyperoxia inactivate endothelium-derived relaxing factor. Am J Physiol 1986 250H822–827[Medline]
  27. ; : Katusic ZS. Superoxide anion and endothelial regulation of arterial tone. Free Radic Biol Med 1996 20443–448[CrossRef][Medline]
  28. ; : Jablonka-Shariff A and Olson LM. The role of nitric oxide in oocyte meiotic maturation and ovulation: meiotic abnormalities of endothelial nitric oxide synthase knock-out mouse oocytes. Endocrinology 1998 1392944–2954[Abstract/Free Full Text]
  29. ; : Chun SY, Eisenhauer KM, Kubo M, Hsueh AJ. Interleukin-1 beta suppresses apoptosis in rat ovarian follicles by increasing nitric oxide production. Endocrinology 1995 1363120–3127[Abstract]
  30. ; : Klein SL, Carnovale D, Burnett AL, Wallach EE, Zacur HA, Crone JK, Dawson VL, Nelson RJ, Dawson TM. Impaired ovulation in mice with targeted deletion of the neuronal isoform of nitric oxide synthase. Mol Med 1998 4658–664[Medline]
  31. ; : Burnett AL, Lowenstein CJ, Bredt DS, Chang TSK, Snyder SH. Nitric oxide: a physiologic mediator of penile erection. Science 1992 257401–403[Abstract/Free Full Text]
  32. ; : Holmquist F, Stief CG, Jonas U, Andersson KE. Effects of the nitric oxide synthase inhibitor NG-nitro-L-arginine on the erectile response to cavernous nerve stimulation in the rabbit. Acta Physiol Scand 1991 143299–304[Medline]
  33. ; : Burnett AL, Chang AG, Crone JK, Huang PL, Sezen SE. Noncholinergic penile erection in mice lacking the gene for endothelial nitric oxide synthase. J Androl 2002 2392–97[Abstract]
  34. ; : Cashen DE, MacIntyre DE, Martin WJ. Effects of sildenafil on erectile activity in mice lacking neuronal or endothelial nitric oxide synthase. Br J Pharmacol 2002 136693–700[CrossRef][Medline]
  35. ; : Hildeman DA, Mitchell T, Teague TK, Henson P, Day BJ, Kappler J, Marrack PC. Reactive oxygen species regulate activation-induced T-cell apoptosis. Immunity 1999 10735–744[CrossRef][Medline]
  36. ; : Ratan RR, Murphy TH, Baraban JM. Oxidative stress induces apoptosis in embryonic cortical neurons. J Neurochem 1994 62376–379[Medline]
  37. ; : Rothstein JD, Bristol LA, Hosler B, Brown RH Jr, Kuncl RW. Chronic inhibition of superoxide dismutase produces apoptotic death of spinal neurons. Proc Natl Acad Sci U S A 1994 914155–4159[Abstract/Free Full Text]
  38. ; : Katschinski DM, Boos K, Schindler SG, Fandrey J. Pivotal role of reactive oxygen species as intracellular mediators of hyperthermia-induced apoptosis. J Biol Chem 2000 27521094–21098[Abstract/Free Full Text]
  39. ; : Ikeda M, Kodama H, Fukuda J, Shimizu Y, Murata M, Kumagai J, Tanaka T. Role of radical oxygen species in rat testicular germ cell apoptosis induced by heat stress. Biol Reprod 1999 61393–399[Abstract/Free Full Text]
  40. ; : Lysiak JJ, Zheng S, Woodson R, Turner TT. Caspase-9-dependent pathway to murine germ cell apoptosis: mediation by oxidative stress, BAX, and caspase 2. Cell Tissue Res 2007 328411–419[CrossRef][Medline]
  41. ; : Ishii T, Matsuki S, Iuchi Y, Okada F, Toyosaki S, Tomita Y, Ikeda Y, Fujii J. Accelerated impairment of spermatogenic cells in sod1-knockout mice under heat stress. Free Radic Res 2005 39697–705[CrossRef][Medline]
  42. ; : Turner TT, Tung KS, Tomomasa H, Wilson LW. Acute testicular ischemia results in germ cell-specific apoptosis in the rat. Biol Reprod 1997 571267–1274[Abstract]
  43. ; : Giorgio M, Migliaccio E, Orsini F, Paolucci D, Moroni M, Contursi C, Pelliccia G, Luzi L, Minucci S, Marcaccio M, Pinton P, Rizzuto R, Bernardi P, Paolucci F, Pelicci PG. Electron transfer between cytochrome c and p66Shc generates reactive oxygen species that trigger mitochondrial apoptosis. Cell 2005 122221–233[CrossRef][Medline]
  44. ; : Andreyev AY, Kushnareva YE, Starkov AA. Mitochondrial metabolism of reactive oxygen species. Biochemistry (Mosc) 2005 70200–214[CrossRef][Medline]
  45. ; : Peltola V, Huhtaniemi I, Ahotupa M. Antioxidant enzyme activity in the maturing rat testis. J Androl 1992 13450–455[Abstract/Free Full Text]
  46. ; : Bauche F, Fouchard MH, Jegou B. Antioxidant system in rat testicular cells. FEBS Lett 1994 349392–396[CrossRef][Medline]
  47. ; : Toda N, Ayajiki K, Okamura T. Nitric oxide and penile erectile function. Pharmacol Ther 2005 106233–266[CrossRef][Medline]
  48. ; : Boffoli D, Scacco SC, Vergari R, Solarino G, Santacroce G, Papa S. Decline with age of the respiratory chain activity in human skeletal muscle. Biochimica et Biophysica Acta-Mol Basis of Dis 1994 122673–82[CrossRef]
  49. ; : De Young L, Yu D, Freeman D, Brock GB. Effect of PDE5 inhibition combined with free oxygen radical scavenger therapy on erectile function in a diabetic animal model. Int J Impot Res 2003 15347–354[CrossRef][Medline]
  50. ; : Petek E, Schwarzbraun T, Noor A, Patel M, Nakabayashi K, Choufani S, Windpassinger C, Stamenkovic M, Robertson MM, Aschauer HN, Gurling HM, Kroisel PM, Wagner K, Scherer SW, Vincent JB. Molecular and genomic studies of IMMP2L and mutation screening in autism and Tourette syndrome. Mol Genet Genomics 2007 27771–81[CrossRef][Medline]
  51. ; : Diaz-Anzaldua A, Joober R, Riviere JB, Dion Y, Lesperance P, Chouinard S, Richer F, Rouleau GA. Association between 7q31 markers and Tourette syndrome. Am J Med Genet A 2004 12717–20
  52. ; : Petek E, Windpassinger C, Vincent JB, Cheung J, Boright AP, Scherer SW, Kroisel PM, Wagner K. Disruption of a novel gene (IMMP2L) by a breakpoint in 7q31 associated with Tourette syndrome. Am J Hum Genet 2001 68848–858[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/4/601    most recent
biolreprod.107.065987v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, B.
Right arrow Articles by Bishop, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, B.
Right arrow Articles by Bishop, C. E.
Agricola
Right arrow Articles by Lu, B.
Right arrow Articles by Bishop, C. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS