| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Testis; |
Departments of Molecular Genetics4 and Pathology and Biology of Diseases,5 Graduate School of Medicine, Kyoto University, Kyoto 606-8501, Japan
The Institute of Physical and Chemical Research (RIKEN),6 Bioresource Center, Ibaraki, 305-0074, Japan
Research Institute for Microbial Diseases,7 Osaka University, Osaka 565-0871, Japan
Department of Pharmacology,8 Kansai Medical University, Osaka 570-8506, Japan
ABSTRACT
Although pluripotent stem cells were recently discovered in postnatal testis, attempts to analyze their developmental potential have led to conflicting claims that spermatogonial stem cells are pluripotent or that they lose spermatogenic potential after conversion into pluripotent stem cells. To examine this issue, we analyzed the developmental fate of a single spermatogonial stem cell that appeared during transfection experiments. After transfection of a neomycin-resistance gene into germline stem cells, we obtained an embryonic stem-like, multipotent germline stem cell line. Southern blot analysis revealed that the germline stem and multipotent germline stem clones have the same transgene integration pattern, demonstrating their identical origin. The two lines, however, have different DNA methylation patterns. The multipotent germline stem cells formed chimeras after blastocyst injection but did not produce sperm after germ cell transplantation, whereas the germline stem cells could produce only spermatozoa and did not differentiate into somatic cells. Interestingly, the germline stem cells expressed several transcription factors (Pou5f1, Sox2, Myc, and Klf4) required for reprogramming fibroblasts into a pluripotent state, suggesting that they are potentially pluripotent. Thus, our study provides evidence that a single spermatogonial stem cell can acquire pluripotentiality but that conversion into a pluripotent cell type is accompanied by loss of spermatogenic potential.
developmental biology, gametogenesis, spermatogenesis, testis
Although the main function of germ cells is to transmit genetic information to the next generation, several studies have uncovered a distinctive developmental program. The first evidence of the pluripotency of germ cells was reported in the 1960s with the finding that teratomas originate from primordial germ cells (PGCs) [1]. In 1992, in vitro studies further showed that PGCs can become pluripotent stem cells when they are cultured with leukemia inhibitory factor (LIF), basic fibroblast growth factor (FGF2), and stem cell factor. These cells, called embryonic germ (EG) cells, are similar to embryonic stem (ES) cells established from the inner cell mass, and they can differentiate into various types of somatic and germ cells [2, 3]. The only difference between ES and EG cells is their epigenetic properties; the level of site-specific methylation for several imprinted genes is reduced in EG cells derived from embryos 11.5 and 12.5 days postcoitum (dpc) [4]. These studies suggest that germ cells have the potential to become pluripotent stem cells.
Importantly, however, the frequency of conversion into teratomas or EG cells decreases as germ cells mature. Although a teratoma was efficiently induced in vivo from 
12.5-dpc PGCs by grafting a fetal genital ridge onto the postnatal testis, this procedure was not effective for embryos at 13.5 dpc or later [1]. Likewise, EG cell formation from PGCs was possible up to 12.5 dpc, but EG cells could not be induced at later stages. The frequency of EG cell formation drops dramatically when genital ridges from 12.5-dpc embryos are used, compared to posterior tissues from 8.5-dpc embryos [4]. These results suggest that such pluripotent cells are no longer available after birth.
However, recent studies suggest that pluripotency persists in the spermatogonial stem cells, the founder cell population for spermatogenesis in the postnatal testis [5, 6]. In 2003, we succeeded in culturing spermatogonial stem cells from postnatal mouse testis. Germ cells formed uniquely shaped colonies when cultured in the presence of glial cell line-derived neurotrophic factor (GDNF) [7]. Even after 2 yr of culture, the cells could produce normal offspring [8]. Based on these properties, we designated these cells as germline stem or GS cells, and both gene trapping and gene targeting vectors were used to produce knockout (KO) mice [9]. Unexpectedly, during our gene targeting experiments, we found ES-like cells in a GS cell culture established from neonatal mouse testis. These cells, designated as multipotent germline stem (mGS) cells, could differentiate into various types of cells in vitro using ES cell differentiation protocols, and they formed germline chimeras by microinjection into blastocysts [10]. However, mGS cells failed to produce spermatogenesis and produced only teratomas after transplantation in the testis [10].
The difference in the developmental potential between the two cell types suggested two possibilities. One possibility is that ES-like cells appeared from residual pluripotential cells that remained from the fetal stage [11]. Alternatively, GS cells dedifferentiate into a pluripotent state during in vitro culture. We favored the latter possibility because it was not possible to directly derive ES-like cells from neonatal testes in either ES or EG cell culture conditions [4, 10]. In this scenario, GS cells convert into mGS cells and lose spermatogonia potential. Recently, another group established multipotent adult germline stem cells from adult testes, which also showed the multipotential nature of spermatogonial stem cells [12]. However, these studies were based on the analyses of a mixture of different kinds of cell populations, which makes it impossible to determine whether spermatogonial stem cells really have such remarkable potential. The definitive experiment requires the cloning of cell populations. In this study, we report the characterization of a clonal line of mGS cells that appeared in our attempt to produce KO animals using a GS cell gene targeting technique. The results presented here support our hypothesis that GS cells dedifferentiate into mGS cells.
Germline stem cells were established from transgenic mouse strain C57BL6/Tg14(act-EGFP-OsbY01) bred into the DBA/2 background (provided by Dr. M. Okabe, Osaka University) using an established protocol [7]. We also used GS cells established from a Trp53 KO mouse [10]. These GS cells were maintained in GS cell culture medium, which was based on StemPro-34 (Invitrogen, Carlsbad, CA) with modifications, as described previously [7]. For the culture of ES (R1 cell line) and mGS cells, a standard ES cell culture medium consisting of Dulbecco modified Eagle medium (DMEM)/15% fetal calf serum was used. In some cases, GS and mGS cells were cultured on laminin- and gelatin-coated dishes, respectively, to avoid contamination with feeder cells [13]. Exponentially growing GS cells were transfected with a Clgn-gene targeting vector by electroporation using Amaxa Nucleofector (Amaxa Biosystems, Cologne, Germany) [14], and G418-expressing cells were selected on G418-resistant mouse embryonic fibroblasts (MEFs) as described previously [15]. In brief, individual colonies were picked up by micromanipulation and mixed with 1000 nontransfected cells in a 96-well plate, 10 days after transfection. The cells were expanded on G418-resistant MEFs throughout the selection, and G418 was added at a concentration of 0.4 mg/ml. Dr. S. Yamanaka of Kyoto University donated pCAG-IP-HA qwmSOX2 and pCAG-mNanog-IP.
For germ cell transplantation, approximately 3 µl of a single-cell suspension containing 1.5 x 104 (GS) or 3 x 105 (mGS) cells was introduced into the seminiferous tubules of 4- to 10-wk-old WBB6F1-W/Wv (W) recipient mice (Japan SLC, Shizuoka, Japan). Because the recipient mice were not histocompatible with the transplanted cells, they were treated with anti-CD4 antibody to induce tolerance to the donor cells [16]. For teratoma induction, 4 x 106 cells were transplanted subcutaneously into KSN nude mice (Japan SLC). Samples were processed for paraffin sectioning and stained with hematoxylin and eosin.
The Institutional Animal Care and Use Committee of Kyoto University approved all of the animal experimentation protocols.
RNA samples were hybridized to a mouse genome 430 2.0 microarray (Affymetrix, Santa Clara, CA) according to the manufacturer's protocol and were scanned with a Gene Chip Scanner (Affymetrix). The data were analyzed using Gene Chip Software v1.4 (Affymetrix).
To confirm our microarray data, quantitative comparisons were made by normalizing the Pou5f1, Sox2, Sox3, Klf4, Myc, Taf4b, Dll1, Kit, Bmi1, Stra8, Bcl6b, Id4, Nanog, Zbtb16, Fas, and Foxc2 expression values to that of hypoxanthine phosphoribosyl transferase using Light Cycler and Light Cycler FastStart DNA Master Plus SYBR Green I (Roche Applied Science, Mannheim, Germany). The PCR conditions were 95°C for 10 min, followed by 40 cycles at 95°C for 5 sec, 61°C for 10 sec, and 72°C for 12 sec. The primers used were 5'-TTTCCCTCTGTTCCCGTCAC and 5'-TGATCAACAGCATCACTGAGC for Pou5f1, 5'-TGGTTACCTCTTCCTCCCACTC and 5'-CCTCCCAATTCCCTTGTATCTC for Sox2, 5'-ACGCGTTCATGGTGTGGTC and 5'-GCAGCGAGTACTTGTCCTTCTTG for Sox3, 5'-CACTACCGCAAACACACAGG and 5'-TTCACAAGCTGACTTGCTGG for Klf4, 5'-TCACCAGCACAACTACGCCG and 5'-CAGGATGTAGGCGGTGGCTT for Myc, 5'-TCACAAGAATCTGCCTCAGG and 5'-GCCACAAAGACAAGACGTAGC for Taf4b, 5'-CAGCTTTAAGGTCCGATACCC and 5'-CGCTTCCATCTTACACCTCAG for Dll1, 5'-AGAAGCAGATCTCGGACAGC and 5'-CATCACAGAAGCCAGAAGGAC for Kit, 5'- GTCCTAACCAGATGAAGTTGCTG and 5'-CCTCCACCTCTTCCTGTTTG for Bmi1, 5'-GGAAGCAGCCTTTCTCAATG and 5'-TTAAACCAGGAACCAGAGCC for Stra8, 5'-TGCATCTGCGTCAGAAACAC and 5'-TAATACCAGGGTAACCCGGC for Bcl6b, 5'-AGCAGGGTGACAGCATTCTC and 5'-TACGGTGAATGCTCGTGAAC for Id4, 5'-ACCAGTGTACCATCTGCACG and 5'-CTGCTCTACCATGTGTTGGG for Zbtb16, 5'-TCTCATGGGAAGAGTGATGC and 5'-AGAACACACCAGGAGTTGCC for Fas, and 5'-CCCAACAGCAAACTTTCCC and 5'-AGAAGGTTCCCATGGAGGAG for Foxc2. The primers used for Nanog were as previously described [10].
Genomic DNA (10 µg) was digested overnight, separated by electrophoresis, and blotted onto Hybond-N+ (Amersham Biosciences, Little Chalfont, UK) according to conventional protocols. Full-length neomycin resistance gene (neo) cDNA was used as a probe for hybridization.
The primary antibodies used were mouse monoclonal IgG1
anti-histone H3, rabbit polyclonal anti-acetyl-histone H3 (Lys 9), rabbit anti-trimethyl-histone H3 (Lys 27), rabbit anti-dimethyl-histone H3 (Lys 9), rabbit anti-trimethyl-histone H3 (Lys 9), rabbit anti-monomethyl-histone H3 (Lys 4), rabbit anti-acetyl histone H3, rabbit anti-acetyl histone H4 antibody (Upstate Biotechnology, Lake Placid, NY), allophycocyanin-labeled rat anti-mouse KIT (2B8), biotin-labeled rat-anti-mouse FAS, rabbit polyclonal anti-KLF4, POU5F1, and goat polyclonal anti-SOX2 (Santa Cruz Biotechnology, Santa Cruz, CA), and rabbit polyclonal anti-MYC and MYCN antibodies (Cell Signaling, Danvers, MA). Peroxidase-conjugated anti-rabbit IgG, anti-mouse IgG (both from Cell Signaling), allophycocyanin-labeled streptavidin (BD Biosciences, Franklin Lakes, NJ) and Alexa 568-conjugated anti-rabbit IgG antibody (Molecular Probes, Eugene, OR) were used to detect the primary antibodies.
The samples were separated by SDS/PAGE, transferred to Hybond-P (Amersham Biosciences), and probed with indicated antibodies.
Immunocytochemistry and Flow Cytometry
The cells were washed, concentrated on glass slides, and fixed in 4% paraformaldehyde at 4°C for 15 min. The cells were then incubated with primary antibodies overnight at 4°C and incubated with secondary antibody at room temperature for 1 h. The slides were counterstained with 4',6-diamidino-2-phenylindole (Dojindo, Kumamoto, Japan) and analyzed under a confocal microscope (LSM510; Carl Zeiss, Oberkochen, Germany). The stained cells were analyzed using a FACS-Calibur system (BD Biosciences) [17].
Combined Bisulfite Restriction Analysis
Combined Bisulfite Restriction Analysis (COBRA) was carried out using the following specific primers: 5'-GGGTGTTAGGAATAGAATTTTAAAAGG and 5'-CCCAACTCATAACTTTAATCCCAACAC for the TaqI site in the distal enhancer (DE), 5'-GTGATTTGAGGGATAGGATTTTAG and 5'-CTCAAAAATCAACCTACCCTCTAC for HpyCH4 IV in the DE, and 5'-GGTTTTTTAGAGGATGGTTGAGTG and 5'-TCCAACCCTACTAACCCATCACC for the proximal enhancer (PE) [10, 18].
Germline stem and mGS cells were dissociated with 0.25% trypsin and were injected into the blastocoel of 3.5-dpc blastocysts from C57BL/6 (B6) mice using a Piezo-driven micromanipulator (Primetech, Ibaraki, Japan).
Transfection of a Clgn Gene-Targeting Vector Into GS Cells
To produce Clgn KO mice, we transfected a gene-targeting construct into GS cells established from green mice that ubiquitously express enhanced green fluorescent protein (EGFP) [7]. The cells were cultured on MEFs for 219–244 days in StemPro-34 medium with epidermal growth factor (EGF), FGF2, LIF, and GDNF (Fig. 1A). The cells were passaged a total of 30–50 times. After transfection, the cells were selected with G418, and resistant clones were established within 3 mo [15]. In total, we obtained 103 clones from 2 x 108 cells. An individual clone was further cultured for 1–2 mo until 107 cells could be recovered.
|
During the expansion of these clones from single colonies in a six-well culture plate, abnormal colonies appeared among the typical GS cell colonies in clone #162. This clone was found in a culture that had been transfected 226 days after culture initiation, and the abnormal colonies were detected 123 days posttransfection (a total of 349 days after initiation of culture). Because the colonies resembled epiblasts, we passaged the cells under ES cell culture conditions using LIF in DMEM. At the same time, we picked GS cell colonies from the same well and clonally expanded them to establish a pure GS cell culture. The epiblast-like cells outgrew the GS cells after two to three passages and were eventually established as mGS cell colonies with a typical ES cell-like appearance (Fig. 1A).
Because the clone #162-mGS cells developed 4 mo after transfection and both clone #162-GS and -mGS cells were resistant to G418, we speculated that the mGS cells might have arisen from a transfected GS cell. To test this possibility, we evaluated the pattern of vector integration by Southern blot. Genomic DNA was digested with EcoRI, SacI, or PstI, which cannot cleave within the neo probe. Hybridization with the neo probe showed that the integration pattern of the transgene varied among the clones, indicating that the transgene was randomly inserted (Fig. 1, B and C). However, identical fragments were produced following digestion of the DNA from #162-GS and -mGS cells with SacI or EcoRI (Fig. 1D), and the same result was obtained following digestion with PstI. These results indicated that both types of cells developed from a single cell that underwent stable transfection of the transgene. Southern blot analysis confirmed that the neo gene was integrated randomly in #162-GS and -mGS cells. No evidence of gene targeting was found in both #162-GS and -mGS cells (Fig. 1E).
Despite their origin, the clone #162-GS and -mGS cells exhibited different growth requirements (Fig. 2A). Germline stem cells grown in StemPro-based medium require GDNF, a self-renewal factor for spermatogonial stem cells [19], and EGF or FGF2 (i.e., GDNF + EGF or GDNF + FGF2). However, the same combinations of cytokines could not induce growth of GS cells in DMEM, and the cells disappeared after several rounds of passage. Leukemia inhibitory factor did not have an apparent effect on GS cell growth. Similar proliferation patterns have been observed for wild-type GS cells established from adult animals. The clone #162-GS cells were cultured for an additional 6 mo, but no mGS cells appeared.
|
In contrast, mGS cells were successfully cultured under typical ES cell culture conditions (i.e., DMEM + LIF), and they grew at a rate comparable to that of ES cells (Fig. 2A). The cells actively proliferated in DMEM in the absence of EGF or FGF2, and GDNF did not enhance their growth. When the cells were cultured in StemPro medium, the mGS cells proliferated actively, but they could not be maintained in an undifferentiated state (Fig. 2B); the cells lost alkaline phosphatase activity and eventually differentiated. In addition, although the effect of LIF was not apparent when mGS cells were cultured on MEFs, their self-renewal was impaired without LIF under feeder-free conditions. When cultured on MEFs, the mGS cells proliferated > 103-fold within 10 days, whereas the GS cells proliferated only 100-fold within 24 days, indicating the greater proliferative potential of mGS cells.
Gene Expression Profiles and Histone Modification Patterns of the GS and mGS Cells
We next examined the gene expression profiles of GS and mGS cells using DNA microarray. Although GS cells expressed several germ cell markers (Fig. 3, A and B, Supplementary Tables 1 and 2 available at www.biolreprod.org), they also expressed several ES cell markers, including all of the genes (Myc, Pou5f1, Sox2, and Klf4) known to induce the conversion of fibroblasts into ES-like cells [20]. However, the expression levels of these genes in GS cells were roughly 5%–40% of those found in mGS/ES cells (Fig. 3B). Although Western blot analysis confirmed the expression of MYC, POU5F1, and KLF4 at the protein level in both cell types, we could not detect SOX2 in the GS cells (Fig. 3C) [21]. We also found that the GS cells expressed MYCN, which has similar functions to MYC [22, 23].
|
|
To gain insight into the mechanism of conversion, we analyzed the regulation of Pou5f1 expression, which is important in ES and germ cells [24]. The Pou5f1 gene has two distinct enhancers, a distal and a proximal. While the DE drives Pou5f1 expression in preimplantation embryos, PGCs, and ES/EG cells, the PE directs its epiblast-specific expression and is dispensable for Pou5f1 expression in ES/EG cells [18, 25]. When the DNA methylation status of these regulatory regions was analyzed by COBRA, the products generated for site 3 in all stem cell types could not be digested with TaqI (Fig. 4, A and B). However, the products that included sites 1 and 2 were highly sensitive to enzymatic digestion in GS but not in ES or mGS cells. This shows that the DE in clone #162-GS cells is more heavily methylated than that in clone #162-mGS and ES cells, which suggests that Pou5f1 expression in GS cells is driven differently than that in ES/mGS/PGCs.
|
To find candidate molecules that are involved in the conversion process, we analyzed GS cells established from Trp53 KO mice (Supplementary Tables 3 and 4). Because Trp53 KO GS cells readily convert into mGS cells, we assumed that these cells have already undergone changes related to the induction of conversion and that analysis of these cells may reveal critical molecules that are directly involved in the conversion process [10]. When we examined the expression patterns of germ cell markers, some of the genes in the Trp53 KO GS cells were significantly upregulated (Fig. 5A). For example, Kit, which is essential for spermatogonial survival [26], was upregulated 7-fold in Trp53 KO GS cells. Other genes, such as Dll1, which is implicated in spermatogonial differentiation, were upregulated 7.5-fold in Trp53 KO GS cells [27]. In contrast, we found that Fas, which plays a role in germ cell apoptosis [28], was significantly downregulated. Flow cytometry confirmed changes in the expression of these genes (Fig. 5B). Whereas germ cell marker expression varied significantly in the Trp53 KO GS cells, the expression of several pluripotency-associated genes was comparable to that in wild-type GS cells (Fig. 3C). Furthermore, the transfected cells continued to proliferate normally with characteristic morula-like appearance, and their growth response to cytokines did not change after a single or double transfection of Nanog- and Sox2-expression vectors; the cells still required the same combinations of cytokines (i.e., EGF + GDNF or FGF2 + GDNF) for in vitro propagation. No significant changes in histone modification were observed, suggesting that the Trp53 KO GS cells are epigenetically similar to wild-type cells (Fig. 5C).
|
Developmental Potential of the GS and mGS Cell Clones
We next examined the developmental potential of the clone #162-GS and -mGS cells. We first used germ cell transplantation to examine the spermatogonial stem cell potential [29]. The clone #162-GS and -mGS cells were cultured for 153 and 130 days, respectively, and were transplanted into the seminiferous tubules of six W mutant mice for each cell type. W mice do not have endogenous spermatogenesis but can support donor-derived spermatogenesis. Three months after transplantation, donor cell colonization was detected in all six males that received a GS cell transplant, and normal spermatogenesis was identified by histological analysis (Fig. 6, A and B). However, all animals that received mGS cell transplants developed teratomas as little as 4 wk after transplantation. Histological analysis confirmed the presence of cell derivatives of the three embryonic germ layers (Fig. 6C). Although similar teratomas were found in nude mice after subcutaneous inoculation with mGS cells, no teratoma was found after injection of GS cells. Southern blot analysis of DNA derived from the teratomas revealed identical integration patterns in clone #162-GS and -mGS cells (Fig. 1D).
|
To test whether the cultured cells contribute to embryonic development, we microinjected them into blastocysts. In our first set of experiments, GS cells were injected into B6 blastocysts. In total, 96 blastocysts were microinjected with GS cells, and 22 offspring were born (Table 1). Although 18 offspring became normal adults, none showed coat color chimerism, and an examination of EGFP fluorescence in their internal organs under ultraviolet light provided no evidence of donor GS cell contribution. In our second set of experiments, we microinjected mGS cells into 81 B6 blastocysts. After embryo transfer, 10 offspring were born, one of which showed apparent coat color chimerism (Fig. 6D); however, this offspring was a runt and did not survive to adulthood. We examined the remaining offspring and found that 1 of them showed significant donor cell contribution in several organs, including some oocyte-like cells in the ovaries (Fig. 6E). These results support the previous finding that mGS cells, but not GS cells, can contribute to chimera formation [22].
This study provides evidence that spermatogonial stem cells are not pluripotent but that a single spermatogonial stem cell can dedifferentiate from a highly lineage-specific state to a pluripotent state. Production of two dissimilar progenies from a single transfected GS cell strongly suggests that they were derived by defective self-renewal division. Because mGS cells could not be maintained in the GS cell medium, the result suggests that stably transfected GS cells underwent unknown changes that resulted in the production of mGS cells. Our study clearly shows that cells in the germline-committed state (GS cells) and the multipotent state (mGS cells) were separate; we never identified any cells in an intermediate state. It will be interesting to examine whether pluripotent cells from adult spermatogonia behave similarly. A similar clonal analysis is necessary to accurately determine the real developmental potential of spermatogonial stem cells.
Although it has been pointed out that mGS cells are originated from residual PGC-like germ cells that persisted in the postnatal testis [11], several lines of evidence suggest that mGS cell formation follows a different mechanism from EG cell formation. For example, PGCs cannot proliferate long-term without becoming EG cells, and the conversion of PGCs into EG cells is induced by cytokines and occurs within several days [2, 3]. In contrast, mGS cells have never been established directly from primary cultures in both ES and EG cell derivation conditions, and they usually appear spontaneously several weeks or months after GS cell culture initiation [8, 10]. Moreover, whereas activation of the phosphoinositide-3 kinase-Akt pathway in PGCs facilitates the conversion of EG cell formation, activation of the same pathway in GS cells did not promote conversion into mGS cells, but it supported the self-renewal division of GS cells [30]. Our results also indicate that mGS cell development is a rare event: only 1 GS cell clone out of 103 gave rise to mGS cells. Importantly, this particular line never generated another mGS cell colony during the ensuing 6 mo of culture. These results suggest that pluripotent cell formation is not a general characteristic of postnatal germ cells. Thus, our study indicates that mGS cells are derived not from a minor, transient cell population in postnatal testes but from a self-renewing stem cell population.
Despite the identical genetic origin of GS and mGS cells, we observed significant differences in their gene expression patterns and epigenetic properties. Particularly, mGS cells lost spermatogonia-specific gene expression and showed enhanced expression of pluripotency genes, the key molecules that can induce ES-like cells from fibroblasts [20]. More interestingly, all of the four pluripotency genes are expressed already at low levels in GS cells. Although it is possible that the conversion could be triggered by elevation in the expression levels of these genes, simple transfection of some of these genes was not sufficient for conversion. The failure to obtain ES-like cells may suggest that germ cells have an unknown mechanism to prevent ES-like cell formation. Alternatively, induction of pluripotency in GS cells may depend on a different combination of genes.
Although the conversion mechanism remains unclear, the involvement of TRP53 in mGS cell formation may provide a clue to this problem. As we reported previously, a loss of TRP53 expression enhances mGS cell development [10]. Recent studies have provided evidence that TRP53 may be involved in the regulation of pluripotency-associated genes. In ES cells, TRP53 suppresses Nanog expression and induces ES cells to differentiate into cell types that can undergo TRP53-dependent cell cycle arrest or apoptosis [31]. Although these results suggest that TRP53 suppresses the conversion via its interaction with NANOG in GS cells, we found little change in pluripotency gene expression in Trp53 KO GS cells. Instead, our results suggest that TRP53 is involved in the regulation of spermatogonia-associated genes, such as Kit or Fas. The functional significance of this alteration in gene expression awaits further analysis, but considering that a loss of either Trp53 or Fas can rescue spermatogenic failure in Kit mutant mice [29, 32], TRP53 and/or FAS may be involved in quality control in spermatogonial stem cells, and the high frequency of conversion of Trp53 KO GS cells into mGS cells may be due to a failure to remove abnormal GS cells.
The next important step is to investigate the molecular mechanism of conversion. As a tissue-specific stem cell, spermatogonial stem cells are probably more resistant to genetic and epigenetic stress than differentiated cells, which may explain the lower incidence of conversion. The low expression levels of pluripotency genes in GS cells suggests the existence of a unique gene regulatory mechanism to suppress pluripotency. This machinery apparently involves TRP53, which suggests that conversion may be closely related to oncogenic transformation. The link between transformation and pluripotency is suggested not only by TRP53 but also by the overexpression of POU5F1 in mGS cells, which was also known as a dose-dependent determinant of oncogenic fate in germ cell tumors [33]. Moreover, high levels of NANOG or SOX2 expression, which are found in mGS cells, have been reported in many tumors [34, 35]. The association of oncogenic transformation with pluripotency may extend to PGCs, because loss of Pten, another suppressor oncogene, enhances EG cell formation [36, 37]. Investigations into the molecular mechanism of conversion, particularly the possible involvement of Trp53 in pluripotency gene regulation, will lead to a better understanding of the regulation of pluripotency in germ cells, and interference with this machinery will improve the efficiency of mGS cell derivation. Such studies will hopefully lead to future clinical applications.
ACKNOWLEDGMENTS
We thank Ms. Y. Ogata and Mr. H. Sakashita for their technical assistance.
FOOTNOTES
1Supported by the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan, Genome Network Project, and by grants from CREST and the Human Science Foundation (Japanese). This work was also supported by the Program for Promotion of Fundamental Studies in Health Sciences of the National Institute of Biomedical Innovation, Takeda Science Foundation, Uehara Memorial Foundation, The Nakajima Foundation, Ichiro Kanehara Foundation, Kowa Life Science, and Suzuken Memorial Foundation. 
Correspondence: 2Mito Kanatsu-Shinohara, Department of Molecular Genetics, Graduate School of Medicine, Kyoto University, Yoshida-Konoe, Sakyo-ku, Kyoto, Japan, 606-8501. FAX: 81 75 751 4169; e-mail: mshinoha{at}virus.kyoto-u.ac.jp
3These authors contributed equally to this work.
Received: 14 October 2007.
First decision: 4 November 2007.
Accepted: 7 December 2007.
REFERENCES
6-integrin are surface markers on mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 1999 965504–5509This article has been cited by other articles:
|
|
 |
|
  S. Takashima, M. Takehashi, J. Lee, S. Chuma, M. Okano, K. Hata, I. Suetake, N. Nakatsuji, H. Miyoshi, S. Tajima, et al. Abnormal DNA Methyltransferase Expression in Mouse Germline Stem Cells Results in Spermatogenic Defects Biol Reprod, July 1, 2009; 81(1): 155 - 164. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Zechner, J. Nolte, M. Wolf, K. Shirneshan, N. E. Hajj, D. Weise, B. Kaltwasser, A. Zovoilis, T. Haaf, and W. Engel Comparative methylation profiles and telomerase biology of mouse multipotent adult germline stem cells and embryonic stem cells Mol. Hum. Reprod., June 1, 2009; 15(6): 345 - 353. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. B. Maki, J. Pacchiarotti, T. Ramos, M. Pascual, J. Pham, J. Kinjo, S. Anorve, and F. Izadyar Phenotypic and molecular characterization of spermatogonial stem cells in adult primate testes Hum. Reprod., June 1, 2009; 24(6): 1480 - 1491. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lee, M. Kanatsu-Shinohara, N. Ogonuki, H. Miki, K. Inoue, T. Morimoto, H. Morimoto, A. Ogura, and T. Shinohara Heritable Imprinting Defect Caused by Epigenetic Abnormalities in Mouse Spermatogonial Stem Cells Biol Reprod, March 1, 2009; 80(3): 518 - 527. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kanatsu-Shinohara, M. Takehashi, and T. Shinohara Brief History, Pitfalls, and Prospects of Mammalian Spermatogonial Stem Cell Research Cold Spring Harb Symp Quant Biol, November 6, 2008; (2008) sqb.2008.73.033v1. [Abstract] [PDF]
|
|
|
|
|
|
A. Zovoilis, J. Nolte, N. Drusenheimer, U. Zechner, H. Hada, K. Guan, G. Hasenfuss, K. Nayernia, and W. Engel Multipotent adult germline stem cells and embryonic stem cells have similar microRNA profiles Mol. Hum. Reprod., September 1, 2008; 14(9): 521 - 529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. G. de Rooij and S. C. Mizrak Deriving multipotent stem cells from mouse spermatogonial stem cells: a new tool for developmental and clinical research Development, July 1, 2008; 135(13): 2207 - 2213. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
