Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print February 27, 2008.
Biol Reprod 2008, 10.1095/biolreprod.107.066423
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/6/1058    most recent
biolreprod.107.066423v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pierce, S. L.
Right arrow Articles by England, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pierce, S. L.
Right arrow Articles by England, S. K.
Agricola
Right arrow Articles by Pierce, S. L.
Right arrow Articles by England, S. K.
BIOLOGY OF REPRODUCTION 78, 1058–1063 (2008)
DOI: 10.1095/biolreprod.107.066423
© 2008 by the Society for the Study of Reproduction, Inc.


Pregnancy; 

Overexpression of SK3 Channels Dampens Uterine Contractility to Prevent Preterm Labor in Mice1

Stephanie L. Pierce 3, Jessica D.K. Kresowik 4, Kathryn G. Lamping 5 6, and Sarah K. England 2 3

Departments of Molecular Physiology and Biophysics,3 Obstetrics and Gynecology,4 Internal Medicine and Pharmacology,5 and Veterans Affairs Medical Center,6 University of Iowa Carver College of Medicine, Iowa City, Iowa 52242

ABSTRACT

The mechanisms that control the timing of labor have yet to be fully characterized. In a previous study, the overexpression of small conductance calcium-activated K+ channel isoform 3 in transgenic mice, Kcnn3tm1Jpad/Kcnn3tm1Jpad (also known as SK3T/T), led to compromised parturition, which indicates that KCNN3 (also known as SK3) plays an important role in the delivery process. Based on these findings, we hypothesized that SK3 channel expression must be downregulated late in pregnancy to enable the uterus to produce the forceful contractions required for parturition. Thus, we investigated the effects of SK3 channel expression on gestation and parturition, comparing SK3T/T mice to wild type (WT) mice. Here, we show in WT mice that SK3 transcript and protein are significantly reduced during pregnancy. We also found the force produced by uterine strips from Pregnancy Day 19 (P19) SK3T/T mice was significantly less than that measured in WT or SK3 knockout control (SK3DOX) uterine strips, and this effect was reversed by application of the SK3 channel inhibitor apamin. Moreover, two treatments that induce labor in mice failed to result in complete delivery in SK3T/T mice within 48 h after injection. Thus, stimuli that initiate parturition under normal circumstances are insufficient to coordinate the uterine contractions needed for the completion of delivery when SK3 channel activity is in excess. Our data indicate that SK3 channels must be downregulated for the gravid uterus to generate labor contractions sufficient for delivery in both term and preterm mice.

ion channels, myometrium, parturition, pregnancy, preterm labor, SK3 channels, smooth muscle, uterus

INTRODUCTION

Throughout gestation, the uterus is maintained in a quiescent state to allow fetal growth and development. Eventually, the relaxed uterus transitions to an active state, with the ability to generate labor contractions in order to expel the fetus at the time of delivery. The exact mechanisms by which labor is initiated have yet to be determined, but the disruption of delivery can lead to complications, such as preterm labor, dystocia, and postterm labor. Genetic mouse models that target proteins thought to be essential for labor in mice and humans often experience normal parturition, which complicates the elucidation of mechanisms that regulate the timing of labor [1]. For example, delayed delivery due to a failure of luteolysis or cervical ripening occurs in knockout mice, in which the genes encoding cyclooxygenase 1 [2], cytosolic phospholipase A2 [3], the PGF2{alpha} receptor [4], or 5{alpha} reductase type 1 [5] are disrupted. In some cases, uterine contractility remains unaltered [5].

One determinant of uterine quiescence is the activity of K+ channels in the myometrium [6, 7]. Potassium channels generate repolarizing and hyperpolarizing currents in myometrial smooth muscle cells (SMCs), thus contributing significantly to uterine quiescence [8, 9]. Accordingly, the regulation of the activities of these channels becomes inherently important as pregnancy progresses so that myometrial tranquility is maintained until contractions are necessary. Both the level of expression and the density of K+ channels in the myometrium change dynamically throughout pregnancy [7, 10, 11]. The K+ channels most intensely studied in terms of their role in pregnancy are the large-conductance calcium- and voltage-sensitive K+ channel, the ATP-sensitive K+ channel, the Shaker-like voltage-gated K+ channels, and the small-conductance, calcium-activated K+ isoform 3 (KCNN3, also known as SK3) channels. Although the expression of other K+ channels changes throughout pregnancy, SK3 channels are the first channels for which overexpression led to a delay or cessation of parturition [12].

Recent studies have shown that transgenic mice overexpressing SK3 channels have compromised parturition [12]. Although the underlying mechanism remains to be proven, the hyperpolarizing potential of SK3 channels, as well as the role of this current in uterine relaxation [13], support the idea that SK3 channel overexpression may abrogate parturition by reducing the ability of the uterus to contract. The SK3T/T mouse is a transgenic knock-in animal, for which the administration of doxycycline results in a functional SK3 knockout (SK3DOX). SK3DOX mice do not exhibit a detectable phenotype, whereas SK3T/T mice show a 2.4-fold increase in channel expression [14]. Parturition is defective in 70% of SK3T/T mice; 40% of these cases involve delayed delivery, and 60% result in dam mortality [12]. In contrast, both heterozygous and SK3DOX mice deliver all fetuses on the appropriate gestational day [12]. These results support the hypothesis that the overexpression of SK3 channels or the failure to downregulate the expression of SK3 channels may delay the onset of labor.

The mechanisms by which SK3 channels modify myometrial function are similar in humans and mice. In recent studies, uterine smooth muscle from nonpregnant (NP) SK3T/T mice showed decreased phasic contractions compared with tissue from their WT counterparts [13]. In contrast, the suppression of SK3 channel expression in urinary smooth muscle increased phasic contractions [14]. Furthermore, in humans, SK3 transcript is lower in term pregnant myometrium than in the equivalent NP tissue [11], implicating the channel in human parturition.

Taken together, the earlier findings led us to hypothesize that SK3 channel expression is downregulated late in pregnancy in order to permit uterine contractions of the magnitude needed for parturition. The experiments undertaken in this study investigated this possibility, with respect to not only the downregulation of SK3 channels but also the consequences of SK3 expression for the generation of contractions and for parturition itself.

MATERIALS AND METHODS

Animals

All animal procedures complied with the guidelines for the care and use of animals set forth by the National Institutes of Health (NIH). The Animal Care and Use Committee at the University of Iowa approved all protocols. SK3T/T mice on a C57BL/6 background were used for this study (gift from John Adelman at the Vollum Institute) [12]. A tetracycline-based genetic switch inserted in the untranslated region of the SK3 gene allowed for site-specific expression and suppression of the gene upon consumption of dietary doxycycline (dox; Bio-Serv, Frenchtown, NJ). Dox feed was administered for at least 1 wk before experiments were initiated to inhibit SK3 channel expression thus generating SK3DOX mice. SK3DOX, WT littermates, and C57BL/6 mice were used as controls for comparison with SK3T/T mice.

Adult female mice were mated at 8 wk of age or later. Day 0 of pregnancy was determined based on the presence of a copulatory plug. Mice were killed by CO2 inhalation on particular days relative to the pregnancy (NP), Days 7, 10, 14, 17, 19 of gestation (P7–P19), and 2 days postpartum (PP2). Uterine tissue was isolated and flash frozen in liquid N2.

Extraction of RNA and Real-Time PCR

The guanidinium isothiocyanate method was used to obtain total RNA from mouse uteri, as previously described [15]. Total RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) to generate cDNA. The cDNA was amplified in triplicate using primers specific for murine Kcnn3 channels (GGGTGTCAAGATGGAACAAA, ATCTTGGAAAGGTCCACCAG) or GAPDH (GCAGTGGCAAAGTGGAGATT, GAATTTGCCGTGAGTGGAGT), and the SYBR Green Supermix (BioRad). GAPDH served as a standard to normalize gene expression.

Electrophysiology

For electrophysiological analysis, NP mouse uterine tissue was removed, cut into 4 mm x 2 mm, and dissociated as previously described [15]. The cell suspension was allowed to settle for ~20 min in an external solution containing (in mM): 135 NaCl, 4.7 KCl, 1 MgCl2, 10 glucose, 2 CaCl2, and 5 HEPES at pH 7.4. The pipette solution containing (in mM): 140 KCl, 0.5 MgCl2, 1 EGTA, 5 ATP, 5 HEPES, and 0.5 free Ca+2 at pH 7.2 was used to fill heat-polished borosilicate pipettes. Cells were patch clamped at room temperature (~22°C). Upon achievement of a gigaohm seal (2–10 g{Omega}), membrane potential was clamped and series resistance compensated. Whole-cell recording was performed as previously described [16]. Briefly, current was measured with a holding potential of –80 mV, and step potentials were elicited from –80 to +120 mV in 20-mV intervals by an Axopatch 200-B (Axon Instruments, Union City, CA) amplifier. Currents were measured in the absence and presence of apamin (500 nM). Commercial pClamp 9.2 software and Digidata 1322A interface (Axon Instruments) were used to acquire and digitize data. The clampfit 9.2 software program (Axon Instruments) was used to calculate mean sustained K+ current amplitudes and normalized to cell size (pA/pF).

Isometric Tension Recordings

P19 mice were killed, and then uterine tissue was isolated and cut into 4 mm x 8 mm strips in Krebs solution containing (in mM): 118.3 NaCl, 4.7 KCl, 1.2 MgSO4, 1.2 KH2PO4, 25 NaHCO3, 2.5 CaCl2, and 11 glucose. Strips were mounted to a force transducer in organ baths filled with oxygenated (95% O2, 5% CO2) Krebs solution at 37°C, and tension was recorded by a Powerlab (ADInstruments, Castle Hill, Australia) data acquisition system. Basal tension (1 g) was applied to the tissue strips and equilibrated for 45 min prior to study. Apamin was added to the bath (500 nM), and tension was recorded for 15 min. Traces obtained before and after apamin addition were compared. To compare contractions between groups, the maximal tension produced by KCl (80 mM) was used to normalize contractions. KCl was used as a control because it increases extracellular K+, leading to a rapid depolarization in excitable cells that is not affected by the outward current of SK3 channels [17]. KCl responses in WT, SK3T/T, and SK3DOX mice did not differ significantly.

Tension recordings were analyzed using Hemolab Software v3.8 [18]. Ten-minute traces obtained prior to and following apamin application were compared. The minimum tension was determined and subtracted from all traces to obtain a baseline. A contraction was defined as any increase in amplitude 50% or greater than the maximal contraction. The heights of the contractions were then determined and averaged.

Immunoblotting

Cell membrane fractions were isolated from mouse uterine tissue as previously described [15], separated by SDS-PAGE, and transferred to nitrocellulose. Membranes were probed with rabbit polyclonal anti-SK3 N-terminal primary antibody (1:100 dilution; Alomone Labs, Jerusalem, Israel) and horseradish peroxidase (HRP)-conjugated goat anti-rabbit Fc secondary antibody (1:3000 dilution; Pierce, Rockford, IL). To assure equal loading, the blots were reprobed with anti-GAPDH primary antibody (1:1000; Chemicon, Temecula, CA) and HRP-conjugated mouse anti-goat secondary antibody (1:3000 dilution; Jackson ImmunoResearch, West Grove, PA). Signal was detected by chemiluminescence (ECL Western Blotting Detection Reagents), and SK3 protein expression was quantitated using densitometry (ImageJ; NIH) and normalized to GAPDH.

Induction of Preterm Labor

At P15, WT, SK3T/T and SK3DOX mice were injected with either lipopolysaccharide (LPS; 100 µg; Escherichia coli, serotype 0111:B4; Sigma, St. Louis, MO) in sterile saline solution or RU486 (mifepristone; 100 µg) in ethanol, as described previously [19, 20]. Delivery was assessed after 24 h. At 48 h after injection, mice were killed and examined for fetal remains within uterine horns, which represented a failure in delivery. Complete delivery was established by the absence of fetuses. For tension-recording measurements, uteri were isolated 8 h after LPS injection. Progesterone withdrawal (as a consequence of LPS administration) was assessed in SK3T/T and WT mice using serum samples obtained via tail vein immediately before and 8 h after LPS injection. Serum progesterone levels were measured by ELISA (DRG Diagnostics).

Statistical Analysis

All data are presented as mean ± SEM. Statistical significance was determined by one-way and two-way ANOVA where appropriate, followed by posthoc comparison using Student t-tests. Success rate of delivery was analyzed using chi-square distribution. Significance was determined at P < 0.05. N refers to number of animals in all cases.

RESULTS

SK3 Expression in Pregnant Mice

To assess the expression of Kcnn3 (also known as SK3) channel transcript during pregnancy, we isolated RNA from NP and pregnant mice at various stages of gestation (NP, P7–PP2; N = 3–6). Real-time PCR (qPCR) analyses revealed that a decrease in SK3 transcript took place by P14 of gestation, which was maintained until term (Fig. 1A). To assess whether SK3 protein levels mimic transcript expression, immunoblotting with SK3-specfic antibodies was performed. Membranes isolated from uterine tissues of NP, P7–P19, and PP2 mice showed that SK3 protein expression decreases with progression of pregnancy, from midgestation onwards (Fig. 1B). Quantification of blots using densitometry further demonstrated this downregulation of SK3 (N = 6; Fig. 1C). Thus, during normal mouse gestation, SK3 channels are downregulated from mid to late gestation.


Figure 01
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIG. 1. Downregulation of SK3 in mouse uteri toward term. A) Real-time PCR analysis of SK3 transcript reveals downregulation in uterine samples at P14 and P19, relative to NP (N = 3–6). B) Western immunoblotting of WT mouse uteri reveals downregulation of SK3 protein throughout pregnancy. C) Densitometry analysis of Western blot data for SK3 protein normalized to GAPDH protein levels (N = 6). Mean ± SEM. *P < 0.05 vs. NP.

K+ Current in Myometrial Smooth Muscle Cells

To assure that SK3 channels were present in myometrial cells and to assess the contribution of SK3 current to total myometrial cell K+ current, whole-cell patch clamping experiments were performed. Myometrial cells isolated from NP WT and SK3T/T mice were held at –70 mV and pulsed in 20-mV steps to 140 mV. At 140 mV, NP myometrial cells showed a 29% reduction in total K+ current after apamin (500 nM) administration (N = 5; Fig. 2A). In contrast, in the myometrial cells of SK3T/T mice, apamin reduced K+ current by 39% (N = 2; Fig. 2B). These data indicate that the SK3 repolarizing current is increased 1.8-fold in SK3T/T mice, coincident with the overexpression of SK3 channels, and are in agreement with other studies that show similar levels of enhancement of SK channel current in smooth muscle cells [14].


Figure 02
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIG. 2. SK3 channel contribution to myometrial cell K+ current. Whole-cell patch clamping trace of NP WT (A) and SK3T/T (B) myometrial cells before and after apamin (500 nM) application.

Uterine Contractility in Mice During Late-Stage Pregnancy

Contractility was measured in P19 uteri isolated from WT, SK3T/T, and SK3DOX mice (Fig. 3). Consistent with reports from other studies, we observed spontaneous uterine contractions in all three experimental groups (Fig. 3A) [21]. Wild-type and SK3DOX uterine strips produced similar peak tension prior to apamin administration, whereas SK3T/T uterine strips produced reduced tension per contraction (Fig. 3A). Apamin (500 nM), which inhibits SK3 channels, did not affect the contractions generated by WT and SK3DOX uterine strips (Fig. 3A), but led to an increase in the contraction strength in SK3T/T strips (N = 5; Fig. 3B). Thus, overexpression of SK3 channels appears to weaken uterine contractility. Apamin did not affect oxytocin-induced contractions as a percentage of maximal KCI response in WT (before: 102.54 ± 9.69; after: 98.91 ± 10.10; N = 4), SK3T/T (before: 112.21 ± 8.68; after: 87.80 ± 6.36; N = 4) or SK3DOX (before: 106.82 ± 7.61; after: 105.54 ± 12.73; N = 3) mice.


Figure 03
View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIG. 3. Spontaneous contractions of WT, SK3T/T, and SK3DOX mouse uteri. A) Tension development (g) of WT, SK3T/T, and SK3DOX taken on P19 before and after apamin (500 nM) application. B) Tension development of uterine strips (percentage of maximal KCl response) produced in WT, SK3T/T, and SK3DOX isometric recordings taken on P19 before and after application of apamin (N = 5). Mean ± SEM. *P < 0.05 vs. SK3T/T values after apamin. **P < 0.05 vs. WT/SK3DOX values before apamin.

Deliveries after Induction of Preterm Labor

We reasoned that, in addition to disruption of parturition at term, the observed reduction in contractile function of the uteri of SK3T/T mice may prevent preterm labor [12]. Although WT and SK3DOX mice completely delivered within 24 h following injection of the labor-inducing agent LPS, SK3T/T mice failed to complete delivery (Table 1). In some instances, SK3T/T mice had a fetus lodged within the birth canal, indicating that labor had begun but fetal expulsion was not achieved.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
 
TABLE 1. Success rate of delivery: The number of mice able to complete delivery by 48 h after injection of 100 µg LPS or RU486.

Similar to isometric tension recordings performed with P19 mice, SK3T/T mice (N = 7) also showed a reduction in the amount of tension produced 8 h after LPS injection at P15 in comparison to its WT (N = 5) and SK3DOX (N = 5) counterparts (Fig. 4A). This further indicates that the overexpression of SK3 channels dampens uterine contractility.


Figure 04
View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIG. 4. Uterine tension development and progesterone levels after LPS injection. A) Force of spontaneous contractions produced by uterine strips (percentage of maximal KCl response) produced in WT, SK3T/T, and SK3DOX isometric recordings performed 8 h after LPS before and after application of apamin (N = 5, 7, and 5, respectively). Mean ± SEM. *P < 0.05 vs. SK3T/T values after apamin. **P < 0.05 vs. WT/SK3DOX values before apamin. B) Progesterone levels (ng/ml) were determined via ELISA in serum samples taken before and 8 h after LPS injection in WT, SK3T/T, and SK3DOX mice (N = 6, 5, and 5). Mean ± SEM. *P < 0.05 vs. before LPS.

The onset of preterm labor in mice injected with LPS coincides with a drop in progesterone levels similar to term deliveries [22]. Wild-type (N = 6), SK3T/T (N = 5), and SK3DOX (N = 5) mice induced to deliver preterm had similar levels of serum progesterone prior to LPS injection (Fig. 4B), and treatment resulted in a significant (and comparable) decrease in progesterone levels in both groups. These data suggest the progesterone withdrawal necessary for the induction of preterm labor occurred in the SK3T/T group, despite the fact these mice were not able to complete delivery.

To eliminate the possibility that the failure of SK3T/T mice to deliver preterm was due to a decrease in responsiveness to LPS, preterm labor was also induced using RU486, a progesterone receptor antagonist. As in the case of induction with LPS, WT and SK3DOX mice were able to complete delivery within 24 h (Table 1), yet SK3T/T mice did not completely deliver (Table 1). Serum progesterone levels were not tested in this case, because RU486 is a progesterone receptor antagonist, reducing receptor function rather than progesterone levels [20].

DISCUSSION

This study addressed the mechanisms that underlie the regulation of parturition by SK3 channels. Our finding that uterine tissue obtained from SK3T/T mice produced significantly less tension per contraction compared with tissue from WT mice suggested that a decrease in uterine contractility is involved in the associated dysfunction of delivery. It also appears likely that SK3 overexpression is responsible for the inability of uteri from SK3T/T mice to contract forcefully enough to complete delivery, since SK3DOX mice produce contractions comparable to those in WT mice. SK3 channels have previously been shown to diminish contractility in the smooth muscle of the bladder [14] and, more specifically, in the NP myometrium [13], exemplifying the role SK3 channels play in the relaxation of various types of smooth muscle tissue.

SK3 channels are widely expressed throughout tissues that are essential for pregnancy and parturition [23]. For example, SK3 is expressed in the hypothalamus [23], where it could affect hormone secretion, thereby leading to compromised parturition. Oxytocin, a hormone whose activities stimulate uterine contractions during labor [24], is released from neurons in the supraoptic nucleus, a region that also harbors neurons and astrocytes that express SK3 channels [25]. It is thus possible SK3 channels regulate oxytocin release. However, oxytocin knockout mice deliver at term [26], indicating oxytocin is not essential for parturition to proceed. This supports the alternative explanation that delayed delivery by SK3T/T mice is due to a decline of myometrial excitability.

Our data show a significant reduction in SK3 channel expression in WT mice midgestation, but the mechanism responsible for this downregulation has yet to be determined. Estrogens have been implicated in SK3 upregulation; SK3 mRNA levels increased in response to injection of 17β-estradiol into the rostral hypothalamus of ovariectomized guinea pigs [27]. Consequently, estrogen surges are important in the regulation of pregnancy and could potentially regulate SK3 channel expression. However, the SK3 gene does not contain an estrogen response element, making a direct interaction with the estrogen receptor unlikely. However, the promoter region of the SK3 gene contains two Sp-binding motifs that are necessary for the estrogen-induced SK3 mRNA upregulation [28]. Since estrogen plays a central role in the progression of pregnancy, this may be one mechanism that contributes to the regulation of SK3 expression in the uterus.

Cervical changes in cellular content and extracellular matrix before parturition are important for successful delivery [29]. Such "ripening" of the cervix is essential to timely parturition in mice, as illustrated by the 5{alpha} reductase type 1 [5] and the transgenic human apolipoprotein B [30] mice, in which these proteins fail to be upregulated and delivery is unsuccessful. Given the presence of SK3 channels in the cervix [23] and their hyperpolarizing influence, it seems likely these channels would contribute to cervical relaxation. Thus, regulation of cervical changes is another possible role for in SK3 channels in parturition.

Although the current study did not specifically examine the endothelial cells that line the myometrium, previous studies have revealed that endothelium-dependent relaxation in human umbilical vein endothelial cells is sensitive to apamin [31]. Such an effect could impinge on uterine contractility, since endothelial cells are abundant in the endometrium [32] and may play a role in pregnancy by contributing to relaxation of the myometrium. Additionally, a previous study using human myometrial tissue samples from NP individuals revealed that SK3 channels are necessary for the relaxant effect of nitric oxide on the uterus [33]. In spite of the fact that SK3 channels are not present in the smooth muscle layer of the vasculature, their presence in the endothelial layer is important to maintain relaxation in resistance arteries [34]. Thus, although SK3 channels are localized in myometrial smooth muscle, their presence in the endometrial layer may impact relaxation of myometrial smooth muscle. This broadens the scope of the hyperpolarizing effects SK3 channels have on smooth muscle, like that found in the myometrium.

The physiological changes in the uterus that are necessary for labor at term also occur during premature labor [35]. Reducing the excitability of the uterus by increasing the expression of SK3 channels could stop the progression of preterm delivery. As mentioned previously, other mouse models also fail in parturition, but many of these are caused by a failure to receive the signals required to initiate parturition [24]. It appears that the SK3T/T mouse, on the other hand, is one of the few models that, despite receiving signals adequate to initiate luteolysis, are nevertheless unable to complete the process of parturition. The failure to complete preterm delivery in SK3T/T mice (Table 1) suggests that SK3 channels could be targeted to prevent, or stop the progression of, preterm labor in humans. This could have a dramatic impact, as preterm delivery accounts for approximately 12.5% of all births in the United States [36], and premature delivery is associated with one third of infant mortality [37]. Current treatments for preterm labor remain largely ineffective and, in some cases, can be harmful to the mother or fetus. The need for a safer, more successful treatment or the development of preventive measures for premature labor makes SK3 channels a compelling target for further investigation.

In the study presented here, we have provided evidence that SK3 channels play a critical role in uterine contractility during pregnancy. Furthermore, we have demonstrated the ability of these channels to prevent the progression of preterm labor in mice. The next step will be to elucidate the mechanisms that control this effect. Ultimately, this will allow the ability to modulate regulation of K+ channels, which could play an important role in the treatment of preterm labor.

ACKNOWLEDGMENTS

The authors thank Chris Bond and John Adelman for their generous gift of the SK3T/T mice; Adam Brainard and Victoria Korovkina for their critical review of the manuscript; Harald Stauss for advice and assistance with the data analysis used for the isometric tension recordings; and Christine Blaumueller for assisting in preparation of the manuscript.

FOOTNOTES

1Supported by the National Institutes of Health (HD-037831 to S.K.E.) and the March of Dimes (21-FY04-169 to S.K.E.). Back

Correspondence: 2Sarah K. England, 51 Newton Rd. BSB 6-555, University of Iowa, Iowa City, IA 52242. FAX: 319 335 7330; e-mail: Sarah-England{at}uiowa.edu

Received: 1 November 2007.

First decision: 28 November 2007.

Accepted: 21 February 2008.

REFERENCES

  1. Kimura T, Ogita K, Kusui C, Ohashi K, Azuma C, Murata Y. What knockout mice can tell us about parturition. Rev Reprod 1999; 4:73–80.[Abstract]
  2. Langenbach R, Morham SG, Tiano HF, Loftin CD, Ghanayem BI, Chulada PC, Mahler JF, Lee CA, Goulding EH, Kluckman KD, Kim HS, Smithies O. Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced inflammation and indomethacin-induced gastric ulceration. Cell 1995; 83:483–492.[CrossRef][Medline]
  3. Uozumi N, Kume K, Nagase T, Nakatani N, Ishii S, Tashiro F, Komagata Y, Maki K, Ikuta K, Ouchi Y, Miyazaki J, Shimizu T. Role of cytosolic phospholipase A2 in allergic response and parturition. Nature 1997; 390:618–622.[CrossRef][Medline]
  4. Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y, Nishimura T, Oida H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K, Murata T, et al. Failure of parturition in mice lacking the prostaglandin F receptor. Science 1997; 277:681–683.[Abstract/Free Full Text]
  5. Mahendroo MS, Cala KM, Russell DW. 5 alpha-reduced androgens play a key role in murine parturition. Mol Endocrinol 1996; 10:380–392.[Abstract/Free Full Text]
  6. Knock GA, Smirnov SV, Aaronson PI. Voltage-gated K+ currents in freshly isolated myocytes of the pregnant human myometrium. J Physiol 1999; 518(pt 3):769–781.[Abstract/Free Full Text]
  7. Lundgren DW, Moore JJ, Chang SM, Collins PL, Chang AS. Gestational changes in the uterine expression of an inwardly rectifying K+ channel, ROMK. Proc Soc Exp Biol Med 1997; 216:57–64.[CrossRef][Medline]
  8. Chanrachakul B, Pipkin FB, Khan RN. Contribution of coupling between human myometrial beta2-adrenoreceptor and the BK(Ca) channel to uterine quiescence. Am J Physiol Cell Physiol 2004; 287:C1747–C1752.[Abstract/Free Full Text]
  9. Liu B, Arulkumaran S, Hill SJ, Khan RN. Comparison of potassium currents in human decidua before and after the onset of labor. Biol Reprod 2003; 68:2281–2288.[Abstract/Free Full Text]
  10. Khan RN, Smith SK, Morrison JJ, Ashford ML. Properties of large-conductance K+ channels in human myometrium during pregnancy and labour. Proc Biol Sci 1993; 251:9–15.[Abstract/Free Full Text]
  11. Mazzone JN, Kaiser RA, Buxton IL. Calcium-activated potassium channel expression in human myometrium: effect of pregnancy. Proc West Pharmacol Soc 2002; 45:184–186.[Medline]
  12. Bond CT, Sprengel R, Bissonnette JM, Kaufmann WA, Pribnow D, Neelands T, Storck T, Baetscher M, Jerecic J, Maylie J, Knaus HG, Seeburg PH, et al. Respiration and parturition affected by conditional overexpression of the Ca2+-activated K+ channel subunit, SK3. Science 2000; 289:1942–1946.[Abstract/Free Full Text]
  13. Brown A, Cornwell T, Korniyenko I, Solodushko V, Bond CT, Adelman JP, Taylor MS. Myometrial expression of small conductance Ca2+-activated K+ channels depresses phasic uterine contraction. Am J Physiol Cell Physiol 2007; 292:C832–C840.[Abstract/Free Full Text]
  14. Herrera GM, Pozo MJ, Zvara P, Petkov GV, Bond CT, Adelman JP, Nelson MT. Urinary bladder instability induced by selective suppression of the murine small conductance calcium-activated potassium (SK3) channel. J Physiol 2003; 551:893–903.[Abstract/Free Full Text]
  15. Benkusky NA, Fergus DJ, Zucchero TM, England SK. Regulation of the Ca2+-sensitive domains of the maxi-K channel in the mouse myometrium during gestation. J Biol Chem 2000; 275:27712–27719.[Abstract/Free Full Text]
  16. Brainard AM, Miller AJ, Martens JR, England SK. Maxi-K channels localize to caveolae in human myometrium: a role for an actin-channel-caveolin complex in the regulation of myometrial smooth muscle K+ current. Am J Physiol Cell Physiol 2005; 289:C49–C57.[Abstract/Free Full Text]
  17. Ratz PH, Berg KM, Urban NH, Miner AS. Regulation of smooth muscle calcium sensitivity: KCl as a calcium-sensitizing stimulus. Am J Physiol Cell Physiol 2005; 288:C769–C783.[Abstract/Free Full Text]
  18. Langager AM, Hammerberg BE, Rotella DL, Stauss HM. Very low-frequency blood pressure variability depends on voltage-gated L-type Ca2+ channels in conscious rats. Am J Physiol Heart Circ Physiol 2007; 292:H1321–H1327.[Abstract/Free Full Text]
  19. Dudley DJ, Chen CL, Branch DW, Hammond E, Mitchell MD. A murine model of preterm labor: inflammatory mediators regulate the production of prostaglandin E2 and interleukin-6 by murine decidua. Biol Reprod 1993; 48:33–39.[Abstract]
  20. Dudley DJ, Branch DW, Edwin SS, Mitchell MD. Induction of preterm birth in mice by RU486. Biol Reprod 1996; 55:992–995.[Abstract]
  21. Crankshaw DJ. Pharmacological techniques for the in vitro study of the uterus. J Pharmacol Toxicol Methods 2001; 45:123–140.[CrossRef][Medline]
  22. Fidel PI Jr., Romero R, Maymon E, Hertelendy F. Bacteria-induced or bacterial product-induced preterm parturition in mice and rabbits is preceded by a significant fall in serum progesterone concentrations. J Matern Fetal Med 1998; 7:222–226.[CrossRef][Medline]
  23. Chen MX, Gorman SA, Benson B, Singh K, Hieble JP, Michel MC, Tate SN, Trezise DJ. Small and intermediate conductance Ca(2+)-activated K+ channels confer distinctive patterns of distribution in human tissues and differential cellular localisation in the colon and corpus cavernosum. Naunyn Schmiedebergs Arch Pharmacol 2004; 369:602–615.[CrossRef][Medline]
  24. Blanks AM, Thornton S. The role of oxytocin in parturition. BJOG 2003; 110(suppl):46–51.[Medline]
  25. Armstrong WE, Rubrum A, Teruyama R, Bond CT, Adelman JP. Immunocytochemical localization of small-conductance, calcium-dependent potassium channels in astrocytes of the rat supraoptic nucleus. J Comp Neurol 2005; 491:175–185.[CrossRef][Medline]
  26. Nishimori K, Young LJ, Guo Q, Wang Z, Insel TR, Matzuk MM. Oxytocin is required for nursing but is not essential for parturition or reproductive behavior. Proc Natl Acad Sci U S A 1996; 93:11699–11704.[Abstract/Free Full Text]
  27. Bosch MA, Kelly MJ, Ronnekleiv OK. Distribution, neuronal colocalization, and 17beta-E2 modulation of small conductance calcium-activated K(+) channel (SK3) mRNA in the guinea pig brain. Endocrinology 2002; 143:1097–1107.[Abstract/Free Full Text]
  28. Jacobson D, Pribnow D, Herson PS, Maylie J, Adelman JP. Determinants contributing to estrogen-regulated expression of SK3. Biochem Biophys Res Commun 2003; 303:660–668.[CrossRef][Medline]
  29. Hertelendy F, Zakar T. Prostaglandins and the myometrium and cervix. Prostaglandins Leukot Essent Fatty Acids 2004; 70:207–222.[CrossRef][Medline]
  30. Word RA, Landrum CP, Timmons BC, Young SG, Mahendroo MS. Transgene insertion on mouse chromosome 6 impairs function of the uterine cervix and causes failure of parturition. Biol Reprod 2005; 73:1046–1056.[Abstract/Free Full Text]
  31. Muraki K, Imaizumi Y, Ohya S, Sato K, Takii T, Onozaki K, Watanabe M. Apamin-sensitive Ca2+-dependent K+ current and hyperpolarization in human endothelial cells. Biochem Biophys Res Commun 1997; 236:340–343.[CrossRef][Medline]
  32. Heryanto B, Rogers PA. Regulation of endometrial endothelial cell proliferation by oestrogen and progesterone in the ovariectomized mouse. Reproduction 2002; 123:107–113.[Abstract]
  33. Modzelewska B, Kostrzewska A, Sipowicz M, Kleszczewski T, Batra S. Apamin inhibits NO-induced relaxation of the spontaneous contractile activity of the myometrium from non-pregnant women. Reprod Biol Endocrinol 2003; 1:8.[CrossRef][Medline]
  34. Taylor MS, Bonev AD, Gross TP, Eckman DM, Brayden JE, Bond CT, Adelman JP, Nelson MT. Altered expression of small-conductance Ca2+-activated K+ (SK3) channels modulates arterial tone and blood pressure. Circ Res 2003; 93:124–131.[Abstract/Free Full Text]
  35. Haram K, Mortensen JH, Wollen AL. Preterm delivery: an overview. Acta Obstet Gynecol Scand 2003; 82:687–704.[CrossRef][Medline]
  36. Martin JA, Hamilton BE, Sutton PD, Ventura SJ, Menacker F, Kirmeyer S. Births: final data for 2004. Natl Vital Stat Rep 2006; 55:1–101.[Medline]
  37. Callaghan WM, MacDorman MF, Rasmussen SA, Qin C, Lackritz EM. The contribution of preterm birth to infant mortality rates in the United States. Pediatrics 2006; 118:1566–1573.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/6/1058    most recent
biolreprod.107.066423v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pierce, S. L.
Right arrow Articles by England, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pierce, S. L.
Right arrow Articles by England, S. K.
Agricola
Right arrow Articles by Pierce, S. L.
Right arrow Articles by England, S. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS