Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print February 6, 2008.
Biol Reprod 2008, 10.1095/biolreprod.107.065706
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Tables
Right arrow All Versions of this Article:
78/6/958    most recent
biolreprod.107.065706v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grzmil, P.
Right arrow Articles by Engel, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grzmil, P.
Right arrow Articles by Engel, W.
Agricola
Right arrow Articles by Grzmil, P.
Right arrow Articles by Engel, W.
BIOLOGY OF REPRODUCTION 78, 958–967 (2008)
DOI: 10.1095/biolreprod.107.065706
© 2008 by the Society for the Study of Reproduction, Inc.

Male Reproductive Tract; 

Prm3, the Fourth Gene in the Mouse Protamine Gene Cluster, Encodes a Conserved Acidic Protein That Affects Sperm Motility1

Pawel Grzmil 2 3 4, Dagmara Boinska 3 4, Kenneth C. Kleene 5, Ibrahim Adham 4, Gregor Schlüter 4, Martin Kämper 4, Byambajav Buyandelger 4, Andreas Meinhardt 6, Stephan Wolf 4, and Wolfgang Engel 4

Institute of Human Genetics,4 University of Göttingen, Göttingen D-37073, Germany Department of Biology,5 University of Massachusetts, Boston, Massachusetts 21225 Department of Anatomy and Cell Biology,6 University of Giessen, Giessen D-35385, Germany

ABSTRACT

The protamine gene cluster containing the Prm1, Prm2, Prm3, and Tnp2 genes is present in humans, mice, and rats. The Prm1, Prm2, and Tnp2 genes have been extensively studied, but almost nothing is known about the function and regulation of the Prm3 gene. Here we demonstrate that an intronless Prm3 gene encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. We also demonstrate that the Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do not generate retroposons. The Prm3 mRNA is first detected in early round spermatids, while the PRM3 protein is first detected in late spermatids. Thus, translation of the Prm3 mRNA is developmentally delayed similar to the Prm1, Prm2, and Tnp2 mRNAs. In contrast to PRM1, PRM2, and TNP2, PRM3 is an acidic protein that is localized in the cytoplasm of elongated spermatids and transfected NIH-3T3 cells. To elucidate the function of PRM3, the Prm3 gene was disrupted by homologous recombination. Sperm from Prm3–/– males exhibited reductions in motility, but the fertility of Prm3–/– and Prm3+/+ males was similar in matings of one male and one female. We have developed a competition test in which a mutant male has to compete with a rival wild-type male to fertilize a female; the implications of these results are also discussed.

gene knockout, protamine gene cluster, protamine 3, quantitative genetic trait, retroposon, spermatogenesis, sperm competition, sperm motility and transport

INTRODUCTION

During spermiogenesis, haploid spermatids undergo complex morphological and physiological changes to differentiate into spermatozoa. These processes include chromatin remodeling mediated by the replacement of histones by transition proteins and protamines [1]. Three of the genes involved in chromatin remodeling encode basic chromosomal proteins, protamine 1 (Prm1), protamine 2 (Prm2), and transition nuclear protein 2 (Tnp2). The Prm1, Prm2, and Tnp2 genes are located in a compact gene cluster in mouse, rat, and human [2–5]. High levels of the Prm1, Prm2, and Tnp2 mRNAs are expressed in spermatids [6], and the mRNAs are translationally regulated: the mRNAs are transcribed in early haploid cells, round spermatids, and stored in a translationally inactive state for ~6 days before being actively translated in late haploid cells, elongated spermatids [7]. Gene knockouts demonstrate that the Prm1 and Prm2 genes are essential for proper spermatogenesis and male fertility [8].

The protamine gene cluster contains a fourth gene, designed protamine 3 (Prm3), located between the Prm2 and Tnp2 genes in rat, human, and mouse [5, 9]. The Prm3 gene has been poorly studied, and many unanswered questions remain concerning its function, expression, regulation, and phylogenetic distribution. In the present study, we demonstrate that the Prm3 gene is conserved in diverse mammals and identify distinctive conserved features of the PRM3 protein. We also demonstrate that the timing of the Prm3 mRNA translation is developmentally regulated in spermiogenesis and that the PRM3 protein is located in the cytoplasm instead of the nucleus. Finally, analysis of a Prm3–/– knockout demonstrates that males lacking the PRM3 protein are fertile, despite reductions in sperm motility.

MATERIALS AND METHODS

Source of Animals

All mouse (Mus musculus) strains used in this study were housed in the Institute of Human Genetics, Goettingen, with food and water ad libitum and light adjusted to 12L:12D. Mouse organs and embryos were isolated postmortem. All experiments were performed in accordance with German legal requirements under licence number 509.42502/01–29.99.

RNA Isolation and Northern Blot Analysis

RNA was isolated from mouse tissues using the RNA Now kit (ITC Biotechnologies, Heidelberg, Germany) according to the manufacturer's instruction. Twenty micrograms of total RNA were separated on a 1.0% agarose-formaldehyde gel and transferred to a nitrocellulose membrane (Hybond C; Amersham, Freiburg, Germany). The membrane was hybridized to the radiolabeled 0.5-kb StyI genomic fragment of rat Prm3 gene [5] in 15 ml of hybridization solution (KPL, Gaithersburg, MD) and 150 µl of denatured salmon sperm DNA (10 mg/ml) at 65°C overnight. The Tnp2 [10], mouse Prm1 [11], and the human elongation factor [12] cDNAs were also used for Northern blot hybridization.

Generation of Anti-PRM3 Antibody

Our initial efforts at producing PRM3 protein in bacteria or mammalian cells were unsuccessful; therefore, we decided to use yeast cells. For expression of PRM-GST fusion protein in yeast, the pGEX vector (GE Healthcare, Buckinghamshire, UK) was modified by replacing the pGEX promoter with the galactose-inducible yeast promoter and by introduction of the URA3 marker and the yeast replication start point, producing the pYGEX vector. The Prm3 ORF (without ATG) was amplified by PCR with P3woABa forward (5'-TCAGGATCCGGTTCCCGCTGTTC-3', containing BamHI restriction site) and M13 vector-specific reverse primer on cDNA template. After sequencing, the Prm3-ORF was subcloned in frame into pYGEX using BamHI and SalI restriction sites, and this construct was used to transform yeast cells. After overnight incubation with galactose, yeast cells were disrupted in 1.5% sarcosyl, 2% Triton X-100, and glass beads (0.5 mm), and the PRM3-GST fusion protein was purified using the glutathione-sepharose 4B (Novagen, Darmstadt, Germany) according to the manufacturer's instruction and used for immunization of rabbits. The serum was used for affinity purification of the polyclonal anti-PRM3 antibody by using the HiTrap affinity columns (Amersham) and the GST-PRM3 fusion protein. Affinity purified antibody was used in Western blot and immunolocalization of the PRM3 protein.

Western Blot Hybridization

Proteins were extracted from mouse tissues and spermatozoa by homogenization in lysis buffer (150 mM NaCl, 10 mM EDTA, 50 mM Tris/HCl, pH 7.6, 1% Triton X-100, and 1% sodium deoxycholate) containing protease inhibitors (1 µg/µl leupeptin/3 µg/µl aprotinin). Proteins (100 µg/lane) were separated by electrophoresis in a 10% polyacrylamide gel and electroblotted to PVDF membranes (Macherey and Nagel, Düren, Germany). Blots were incubated overnight with anti-PRM3 antibodies (dilution 1:100) at 4°C. After extensive washing, blots were incubated for 1 h at room temperature with anti-rabbit IgG conjugated with alkaline phosphatase or peroxidase (dilution 1:10 000; Sigma, Duisenhofen, Germany). Bound antibodies were detected by color reaction or by chemiluminescence (Roche, Mannheim, Germany). Protein loading was assessed by probing the blots with a monoclonal anti-{alpha}-tubulin antibody (dilution 1:500; Sigma).

Two-Dimensional Gel Electrophoresis

Isoelectric focusing (IEF) was carried out by using Bio-Rad PROTEAN IEF-Cell [13] and immobilized pH gradient (IPG) strips (Immobiline DryStrip, pH 3–10, lengths 7 and 11 mm; Amersham). Five and 10 µg of protein samples were overnight absorbed on the IPG strips, than focused in an automated run at 20°C: 1 h at 200 V, 1 h at 500 V, 30 min at increasing voltage 500-4000 V, and 1.5 h at 4000 V for 7-mm strips. IPG strips were equilibrated and resolved on 10% or 12.5% SDS-polyacrylamide gels (80 x 80 x 1 mm), and proteins was blotted onto PVDF membranes and probed with anti-PRM3 antibody as described for Western blot.

Subcellular Localization of PRM3-EGFP Fusion Protein and Immunostaining

The cDNA encoding Prm3 (without ATG) was cloned in frame into the pEGFP-C1 vector (Clontech, Heidelberg, Germany) and verified by sequencing. NIH3T3 cells were transfected with the Prm3-EGFP vector using the Superfect reagent according to the manufacturer's instructions (Qiagen, Hilden, Germany). Cells were harvested 16–24 h after transfection and replated on multiwell chamber slides (Nunc, Wiesbaden, Germany) and fixed with 4% paraformaldehyde in PBS.

For immunostaining, testicular sections were prepared as described previously [14]. Slides were incubated with the anti-PRM3 antibody at 4°C overnight (dilution 1:40), washed four times for 5 min in PBST, and subsequently incubated with Cy3-conjugated goat anti-rabbit antibodies (dilution 1:10 000; Sigma). The sections were then incubated with FITC-conjugated peanut-lectin for 20 min to stain the acrosomes, followed by four additional washes.

Finally all slides were mounted with coverslips using Vectashield mounting medium containing 4'6'-diaminido-2-phenylindole (DAPI) (Boehringer, Mannheim, Germany) and analyzed using an Olympus BX60 fluorescence microscope.

For nonfluorescent immunostaining, testicular sections were prepared and incubated with anti-PRM3 antibodies as described previously and then incubated with alkaline phosphatase-conjugated goat anti-rabbit antibody (dilution 1:500; Sigma) for 1 h at room temperature. After a washing step with PBS, immunoreactivity was detected by incubating the sections with a solution containing Fast red TR/naphthol AS-MX phosphate tablets (Sigma) and analysed using the Zeiss microscope.

Generation of Prm3 Knockout Mice

A phage clone containing mouse protamine gene cluster was isolated from the C129/ES library (Genome Systems, Cambridge, UK) using PCR screening [5]. The 3.4-kb genomic fragment containing the 5' flanking region of Prm3 gene was amplified using primers: SacIIKOF (5'-TTTTCCGCGGTTTTGGTTTTGCTTTGGTTA-3') and NotIKOR (5'-AAAAGCGGCCGCGGAATGATTGGGGTAGAGTA-3'). The 3.4-kb SacII/NotI amplified fragment was cloned into the pTKNeo3 [15]. The 3' flanking region of Prm3 gene was generated by ligation of the 1.2-kb ClaI/EcoRI fragment, which was generated by PCR using the ClaIKOF (5'-AAGAGTCTCCATCGATCTCTCTTGGTCTCC-3') and EcoRIKOR (5'-TCTGAAGAATTCCCTCTCACCACCACCCATGCA-3') and the 4.1-kb EcoRI/XhoI fragment isolated from the genomic phage clone. Both fragments were subcloned into the pTKNeo3 vector. Linearized construct DNA (30 µg) was electroporated into 129SV derived embryonic stem (ES) cells. Genomic DNA was isolated from colonies resistant to G418 (400 µg/ml) and gancyclovir (2 µM), digested with SstI, and hybridized with a 0.4-kb-long external probe. Homologous recombined ES cells were injected into C57Bl/6J blastocysts to produce chimeric animals [16]. Chimeric males were mated to C57BL/6J and 129/Sv females, respectively, and F1 offspring were genotyped by PCR. To amplify wild-type allele, primer pair P3FP (5'-GAAGAAGAGGAAGAGGAGCAA-3') and P3RP (5'-AAAGGGAAAGAGGGAGACCAA-3') was used, and for the mutant allele, primers NeoF1 (5'-ATCTCCTGTCATCTCACCTTGC-3') and NeoR3 (5'-AGCAATATCACGGGTAGCCAAC-3') were used. The product size was 231 base pairs (bp) for wild-type allele and 386 bp for mutant allele.

Analysis of Male Fertility, Testis Histology, and Spermatozoa Quality

In order to determine the fertility of PRM3-deficient males, 10 adult Prm3–/– males were mated each with two CD1 females. Additional 10 Prm3–/– males were intercrossed with Prm3–/– females. Females were checked for pregnancy and the number of litters was determined during a 3-mo period.

For histological analysis, testes were fixed in Bouin fixative and embedded in paraffin, and 4-µm sections were stained with hematoxylin and eosin and photographed using a Zeiss microscope. For electron microscopy, testicular and epididymal tissue was cut into small pieces and fixed by immersion in 3.5% glutaraldehyde and 1% paraformaldehyde in 0.1 M cacodylate buffer (pH 7.4). Specimens were washed in 0.1 M cacodylate buffer containing 0.1 M sucrose and postfixed in 1% osmium tetroxide. Ultrathin sections were stained with 1% uranylacetate in cacodylate buffer and examined by electron microscopy.

Epididymides of eight Prm3–/– mutant males and eight control animals were collected and dissected in IVF medium. Sperm number in cauda epididymis was determined using the Neubauer cell chamber. To investigate the acrosome reaction, spermatozoa were capacitated for 1.5 h in Tyrode medium and then incubated for 5 min at 37°C in 5% CO2 with Tyrode medium plus 20 µM calcium ionophore A23187 (Sigma-Aldrich, Tanfkirchen, Germany). The percentage of acrosome-reacted spermatozoa was determined by staining with Coomassie brilliant blue R250 as previously described [17]. At least 200 spermatozoa from three males were examined for the presence of the characteristic dark blue acrosomal crescent.

For statistical analysis, Student t-test for independent groups was used. Data are given as a mean ± standard deviation.

Epididymal spermatozoa were used for motility analysis. Epididymides were disrupted with a needle, and spermatozoa were allowed to swim out for 10 min in 37°C, 5% CO2. Epididymes were discarded, and spermatozoa were incubated for 1.5, 3.5, and 5.5 h at 37°C, 5% CO2. Thirteen microliters of the sperm suspension were transferred to the incubation chamber, which was preset to 37°C. Sperm movement was quantified using the CEROS computer-assisted semen analysis system (version 10; Hamilton Thorne Research, Beverly, MA). Spermatozoa from three mutant mice and two wild-type control males were analyzed using the following parameters: negative phase-contrast optics; recording, 60 frames per second; minimum contrast 60; minimum cell size 6 pixels; and minimum static contrast 15 pixels. Slow motile cells were not included to avoid counting sperm that are moved by other sperm or Brownian motion and low-velocity nonprogressive sperm. For statistical analysis, frequencies of the six sperm motility parameters—ALH (amplitude of lateral head displacement, µm), BCF (beat cross frequency, Hz), VAP (average path velocity, µm/sec), VSL (straight line velocity, µm/sec), VCL (curvilinear velocity, µm/sec) and STR (straightness, calculated as a ratio of VSL to VAP, expressed in %)—were examined by probability plots categorized by mouse type (wild-type/mutant) and time of observation (1.5, 3.5, and 5.5 h after preparation). All parameters were not normally distributed or could not be normalized by any kind of transformation. Therefore, the nonparametric alternative for the t-test, the Wald-Wolfowitz runs test, was used. The P-value below 0.01 was considered significant. For calculation, sperm motility measurements of each parameter were pooled for each individual mouse strain and for each time point. All statistical analyses were performed using the Statistica software package (StatSoft, Inc., Tulsa, OK).

In Vitro Fertilization

Adult Prm3–/– and control Prm3+/+ male mice were used for this experiment. First, the wild-type CD1 female mice were superovulated, and the oocytes were collected after 10–12 h of hCG administration. The cumulus cells were removed from the oocytes by hyaluronidase treatment, and the competition in vitro fertilization (IVF) analysis was performed as described previously [18]. In brief, the spermatozoa were isolated from the cauda epididymis and capacitated as described previously, and equal numbers of spermatozoa (1.1 x 105 each) from Prm3–/– and Prm3+/+ males were mixed together. The mixed spermatozoa in IVF medium (MediCult, Jyllinge, Denmark) were then added to the oocytes in 500 µl of IVF medium and incubated for 6 h at 37°C in 5% CO2 covered with mineral oil. After fertilization, the oocytes were washed and further cultured in M16 medium until four-/eight-cell-stage embryos. Each embryo was collected into a PCR tube with 4 µl of water and then boiled at 95°C for 10 min and subsequently frozen at –80°C for 15 min. This boiling/freezing step was repeated again, and the DNA obtained from the lysed embryos was used in PCR genotyping (see Generation of Prm3 Knockout Mice). However, in this PCR genotyping, we used only 30 cycles for amplification, and then 0.5 µl from the first PCR reaction was used as a template in a nested PCR with the following primers: P3FP1 (AGGAGCAAATCCCGGTGAAG) and P3RP1 (GGGAAAGAGGGAGACCAAGAGAG) for the wild-type allele and NeoF11 (GCATACGCTTGATCCGGCTAC) and NeoR31 (CACGGGTAGCCAACGCTATG) for the knockout allele. The product size was 215 bp for the wild-type allele and 311 bp for the mutant allele. As a control, DNA from wild-type oocytes fertilized with wild-type spermatozoa was used for PCR reactions. The competition IVF was repeated twice using different male mice.

Competition Test

In order to determine whether the mutant males have any disadvantages compared with wild-type males, a competition breeding test was performed. At day of birth, Prm3–/– knockout males and wild-type CD1 males were put in one cage and allowed to grow up together. Males that grow up together usually are not aggressive against each other in adulthood, which allowed us to keep two adult males of different genotypes in one breeding cage. One adult Prm3–/– and one Prm3+/+ male were put together into a large test cage (200 x 100 cm, 150 cm high) with four CD1 females. Animals were maintained with 12-h periods of dark/light with free access to the standard mouse chow and tap water. After 17 days, females were transferred to normal breeding cages and allowed to deliver. Genotypes of all offspring were determined by PCR. This competition-breeding experiment was repeated twice using new males and females. To avoid misleading results that would be produced if one of the males were infertile, each male from the competition test was mated with two wild-type females in a normal breeding cage. Only fertile males were considered for data analysis of the competition test.

RESULTS

The Prm3 Gene Is Conserved in Diverse Mammalian Genomes

To determine whether the Prm3 gene is conserved in diverse mammals, we searched the genomic sequence ENSEMBL databases with conserved PRM3 amino acid queries and TBLASTN (http://www.ensembl.org/index.html). Figure 1 shows a CLUSTAL multiple, global alignment (http://www.ebi.ac.uk/Tools/clustalw2/index.html) of hits from 13 species and seven orders of mammals including Rodentia (rat and mouse), Primata (bush baby, rhesus monkey, chimpanzee, and human), Artidactyla (horse and bull), Carnivora (dog and cat), Afrosoricida (tenrec), Chiroptera (little brown bat), and Proboscidea (African elephant). In addition, a pig Prm3 expressed sequence tag (EST) was identified. The alignment demonstrates that PRM3 is a distinct protein that can be easily recognized by several conserved features including 11 amino acids at the amino terminus, a 26-amino-acid central segment, a polyglutamic acid tract containing 11–19 residues, another eight conserved amino acids, and a C-terminal carboxy terminal serine. By using the SMART program (http://smart.embl-heidelberg.de [19]), the putative coiled coil region, between animoacids 41 and 71, was found. The Prm3 coding sequence in all 14 mammals is contained in a single exon as reported previously [5, 9]. BLAST [20] searches reveal that the Prm3 gene is tightly linked to the Tnp2 and/or Prm2 genes in 11 species (Kleene, unpublished results), indicating that these Prm3 genes are orthologues. The position of the Prm3 gene in relation to the Tnp2 and Prm2 gene cannot be established at present in pig, elephant, and tenrec because these genomes are incomplete. These findings demonstrate that the Prm3 gene and its presence in the protamine cluster are conserved in a wide variety of mammals.


Figure 01
View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 1. CLUSTAL multiple global alignment of PRM3 amino acid sequences in various mammals. PRM3 in genomic DNA sequences of various mammals were identified using TBLASTN and the N-terminal 44 amino acids of mouse PRM3 (NP_038666) as a query in the ENSEMBL database (http://www.ensembl.org/Multi/blastview). Pig PRM3 was identified in ESTs. The PRM3 amino acid sequences were generated from the genomic sequences by virtual translation and aligned with CLUSTAL W. The taxonomic classification of each species and the ENSEMBL sequence identification information for each sequence are listed in Supplemental Table 1 (available at www.biolreprod.org).

No significant similarity could be detected on the DNA or protein level between Prm3 (GeneID: 19120) and Prm1 (GeneID: 19118) or Prm2 (GeneID: 19119) using BLASTP or BLASTN. Using the Protein Calculator software (http://www.scripps.edu/~cdputnam/protcalc.html), we calculated the theoretical molecular weight (11 409) and the isoelectric point (4.26) of PRM3. To verify these theoretical predictions, the PRM3 protein was analyzed in a two-dimensional Western blot. The PRM3 protein was detected at pH 4–5 and a molecular weight of ~14 kDa (Fig. 2). Thus, in contrast to PRM1, PRM2, and TNP2, PRM3 is an acidic protein.


Figure 02
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 2. Mouse testicular proteins were subjected to two-dimensional electrophoresis and blotted. PRM3 protein was detected using the anti-PRM3 antibody by pH 4–5; as a control, one-dimensional Western blot analysis of testicular protein was performed.

The Prm3 Gene Has Not Generated Retroposons

TBLASTN and BLASTN searches of the genomes in the ENSEMBL database (http://www.ensembl.org/Multi/blastview) reveal that the Prm3 gene in 12 of the 13 species of mammals is a single copy. The one exception is bull, which contains two identical copies of the Prm3 gene on chromosome 25. The two bull Prm3 genes represent duplications of genomic DNA or an error in sequence assembly because the genes are closely linked, and the duplicates retain 5' flanking and 3' flanking sequences and lack a remnant of the poly(A) tail, one of the hallmarks of retroposons [21]. Moreover, the observations that all 13 of the Prm3 genes lack the remnant of a poly(A) tail and 11 of these genes are present in the protamine gene cluster argues that none of these genes were duplicated by retroposition, a process by which an mRNA is copied by reverse transcriptase and the DNA copy is inserted back into the genome. These observations support the idea that genes that are expressed in meiotic and haploid spermatogenic cells have not generated retroposons [22, 23].

Expression Analysis of the Prm3 Gene and PRM3 Protein

The localization of the Prm3 gene within the gene cluster containing testicular expressed genes as Prm1, Prm2, and Tnp2 [24, 25] led us to suspect that Prm3 might be also expressed in spermatids and that translation of the mRNA might be developmentally regulated. To analyze the expression of the Prm3 gene, RNA from various mouse tissues was hybridized with radioactive labeled Prm3 cDNA probe. The Prm3 transcript could be detected only in RNA isolated from testis (Fig. 3A). Western blot analysis demonstrates that the ~14-kDa PRM3-specific band was detected only in extracts of testis but not in epididymis or spermatozoa extract (Fig. 3B). To determine when the Prm3 mRNA and protein are expressed during spermatogenesis, Northern blots with RNA isolated from the testes of males at different ages postpartum were hybridized with Prm3 cDNA probe. The Prm3 transcript was first detected in testes of 20-day-old mice (Fig. 3C), an age when the first postmeiotic cells are present [26], whereas the PRM3 protein was first detected 5 days later at 25 days postpartum (Fig. 3D). To confirm the haploid expression of Prm3 gene, RNA isolated from testes of adult mutant males with spermatogenesis arrested at different stages was analyzed by Northern blots—W/Wv mutants with no germ cell in the testis, Tfm with primary spermatocytes, olt/olt with spermiogenesis affected after step 13 spermatids, and qk/qk with elongated spermatids (step 16) [27, 28]—and hybridized with Prm3 cDNA probe. Prm3 transcript was detected only in olt/olt and qk/qk mutants but not in Tfm or W/Wv (Fig. 3E). The PRM3 protein could also be detected in olt/olt and qk/qk mutants (Fig. 3F). This analysis demonstrates that the Prm3 gene is first transcribed in early spermatids and that the PRM3 protein is first detected about 5 days later, implying that the Prm3 mRNA is translationally repressed in early spermatids.


Figure 03
View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 3. Expression of Prm3 and PRM3 in various tissue and testicular cell types. A) Northern blot with total RNA prepared from adult mouse tissues hybridized with Prm3 cDNA probe. The 0.4-kb Prm3 transcript could be detected exclusively in the testis. B) Anti-PRM3 antibody detected the 14-kDa (MW = 11409) PRM3 protein in the testis but not in the epididymis or spermatozoa. C) In the RNA isolated from testes at different postnatal stages, the Prm3 transcript could be observed first in testis at 20 days postpartum (dpp). D) The PRM3 protein was first detected at 25 dpp. Prm3 mRNA and protein (E and F) could be detected in the testis of qk/qk and olt/olt mutants as well as in adult wild-type males. In contrast, Prm3 expression was not observed in testis from W/Wv and Tfm mouse mutants. The RNA quality is demonstrated either by ethidium bromide staining or by hybridization with HEF probe, and protein quality was verified using anti-{alpha}-tubulin antibody. WT, Wild-type; MW, molecular weight given in thousands.

Cellular Localization of the PRM3 Protein

Since PRM3 is an acidic protein, it is not necessarily a chromosomal protein like PRM1, PRM2, and TNP2. To investigate the intracellular localization of PRM3, testis sections were probed with anti-PRM3 antibodies (Fig. 4A). To differentiate between round and elongated spermatids, sections were stained with a FITC-conjugated lectin that specifically stains the acrosome (Fig. 4B, inserts). Cell nuclei were counterstained with DAPI (Fig. 4C). PRM3 could be detected in elongated spermatids, starting from step 9, but not in round spermatids (Fig. 4D). To confirm this finding, testis sections were again probed with anti-PRM3 antibodies, and the immunoreactivity was visualized by nonfluorescent method. Strong signals can be observed in the elongated spermatids (Fig. 4E, arrow), whereas round spermatids remained unstained (Fig. 4E, arrowhead). Surprisingly, the PRM3 was localized in the cytoplasm of elongated spermatids (Fig. 4D, insert) rather than in nuclei. To confirm the subcellular localization of the PRM3, NIH3T3 cells were transfected with the EGFP-PRM3 fusion vector. The GFP fluorescence was detected in cytoplasm of transfected cells (Fig. 4, E–G).


Figure 04
View larger version (119K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 4. Localization of the PRM3 protein. A) Testicular sections were immunostained with anti-PRM3 and Cy3-conjugated secondary antibody. B) FITC-conjugated lectin was used to stain the acrosome of round and elongated spermatids (see inserts), and (C) cell nuclei were counterstained with DAPI. D) Overlay: The PRM3 protein was detected in elongated (arrow) but not round spermatids. In elongated spermatids the protein is detected in the cytoplasm (insert). E) Testicular sections were probed with anti-PRM3 and alkaline phosphatase-conjugated secondary antibody. Elongated spermatids are stained (arrow), whereas no signal was detected in round spermatids (arrowhead). F) The PRM3-EGFP fusion plasmid was used for transfection of mouse NIH3T3 cells, and (G) cell nuclei were counterstained with DAPI. H) Overlay: The PRM3-EGFP fusion protein was detected in the cytoplasm of NIH3T3 cells. Magnification x600.

Prm3 Knockout Mice Exhibit Normal Spermatogenesis and Fertility

The conservation of the Prm3 gene in diverse mammals and its expression in spermatids implies that the Prm3 gene might play an important role in spermatogenesis. To determine the function of Prm3, the gene was disrupted by homologous recombination using a targeting vector that deletes the entire Prm3 gene (Fig. 5A). ES cells from 129Sv mouse strain were transfected with the targeting vector and selected for neomycin/gancyclovir resistance. Homologous recombinants were identified by Southern blot analysis of SstI-digested ES cell DNA using the 3' external probe (Fig. 5B). Two homologous recombinant ES clones were injected into C57BL/6J blastocysts to generate chimeras. One of the chimeras, which transmitted the mutant allele into germ line, was intercrossed to C57BL/6J and 129/Sv mice to establish the Prm3-disrupted allele on C57BL/6Jx129/Sv hybrid background and on the 129/Sv inbred background, respectively. On both backgrounds, heterozygous F1 mice were bred together to obtain homozygous mutant animals in the F2 generation. The PCR analysis of the F2 progeny (Fig. 5C) revealed the normal Mendelian ratio of wild-type, heterozygous, and homozygous animals. The lack of expression of the Prm3 in the mutants was confirmed by Northern and Western blots (Fig. 5D, E). To determine whether the insertion of neocassette influenced the expression of the neighbouring genes, Northern blots with RNA isolated from the testis of Prm3–/– and Prm3+/+ males were probed with Prm1 and Tnp2 cDNAs. Expression of both genes was found to be unaffected (Fig. 5F).


Figure 05
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 5. Targeted disruption of Prm3 gene. A) Structure of the wild-type and recombinant alleles are shown, and relevant restriction sites (C, ClaI; E, EcoRI; N, NotI; SI, SacI/SstI; SII, SacII; X, XhoI) and applied primers (P3FP, P3RP, NeoF1, and NeoR3) are given. Knockout strategy was designed to replace the entire Prm3 gene by the pgk-neo cassette (Neo). TK, Thymidine kinase cassette. B) Southern blot analysis with SstI-digested genomic DNA of recombinant ES cells. The external probe detected 20-kb wild-type and 16-kb recombinant SstI-fragment. C) PCR genotyping of F2 generation mice. Using P3FP, P3RP primers, a 231-bp wild-type fragment, and NeoF1, NeoR3 primers, a 386-bp recombinant fragment was amplified. D) Northern blot with total RNA isolated from the testis of Prm3–/– and Prm3+/+ males using the Prm3-specific cDNA probe. No Prm3 expression could be detected in Prm3–/– testis, and the RNA quality was verified using the HEF probe. E) In addition, no PRM3 protein could be detected in the testis of Prm3–/– males using the anti-PRM3 antibody in Western blot. As a control, anti-{alpha}-tubulin antibody was used. F) The unaffected expression of neighboring genes Prm1 and Tnp2 was demonstrated by Northern blot. WT, Wild-type.

Breeding of 10 Prm3–/– males and 10 Prm3–/– females with wild-type animals revealed that both mutant males and females were fertile. By breeding Prm3–/– males with Prm3–/– females, normal litter size was observed (7.4 ± 2.9 comparing to 6.2 ± 2.8 for wild-type, P = 0.16). Histological and electron microscopy analysis of the testis did not reveal any obvious morphological changes in the testes and sperm of Prm3–/– males (data not shown). To further investigate the consequences of the Prm3 gene disruption on spermatogenesis, we determined the parameters of epididymal spermatozoa of 8 Prm3–/– and 8 Prm3+/+ males. No significant difference could be found in mean sperm number (0.9 ± 0.9 x 107 for Prm3–/– and 1.4 ± 0.8 x 107 for Prm3+/+; P = 0.22) and acrosome reaction (84.9% ± 2 acrosome-reacted spermatozoa in Prm3–/– and 91.6% ± 1 acrosome-reacted spermatozoa in Prm3+/+; P = 0.47). The sperm motility parameters were also analyzed using the CASA system. The following parameters were analyzed: ALH and BCF describe sperm head activity; VAP, VSL, and VCL measure several sperm velocity parameters; and STR (straightness) provides information about path shape. The measurement was done first after 1.5 h of incubation, the time it takes mouse spermatozoa to undergo capacitation in vitro [29], and additional measurements was performed after 3.5 and 5.5 h to find out whether sperm motility parameters change with time. The statistical analysis of the results revealed that mutant and control strains differ significantly (P < 0.01) in VAP, VSL, ALH, and BCF after 1.5 h and in all parameters after 3.5 h (Fig. 6). After 5.5 h of incubation, no significant difference between mutant and wild-type males could be observed (not shown). The detailed result of statistical analysis is given in Supplemental Table 2 (available at www.biolreprod.org).


Figure 06
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 6. The analysis of motility parameters of sperm from Prm3–/– males. On the x-axis, the incubation time and the genotype of animals are given, and on the y-axis, the value of particular parameter is given. In the mutant, N1.5hrs (number of spermatozoa analyzed after 1.5 h of incubation) = 1114, N3.5h = 1523, and in the wild-type, N1.5h = 1709 and N3.5h = 2450. After 1.5 h of incubation, spermatozoa of Prm3–/– and Prm3+/+ differ significantly in VAP (P < 0.05), VCL (P < 0.01), ALH (P < 0.01), and BCF (P < 0.01), and after 3.5 h of incubation, they differ significantly in all analyzed parameters (P < 0.01).

Competition Test

The analysis of sperm motility parameters revealed that deletion of Prm3 gene decreases sperm motility, although the males are fertile and produce normal numbers of offspring in matings of one male and one female. We next addressed the question whether Prm3–/– males have a disadvantage in competitive mating with Prm3+/+ males. The theoretical basis of this question is that the females of most mammals mate promiscuously with multiple males, producing a situation in which the sperm from rival males compete in the female reproductive tract to fertilize the egg [30]. Sperm competition creates powerful selective pressures on gene expression in spermatogenic cells, affecting sperm number, sperm motility, and many other attributes of sperm physiology [31]. This line of reasoning suggests that the effects of decreased motility of Prm3–/– sperm on male fertility might be more readily observed in competitive matings with Prm3+/+ males than in noncompetitive matings.

To address this matter, first, a competitive in vitro fertilization experiment was performed. After 6 h of incubation of wild-type oocytes with mixtures of spermatozoa isolated from Prm3–/– and Prm3+/+ males, embryos were washed, let to develop until the four-/eight-cell stage, isolated separately, and genotyped by PCR. In the first competitive IVF assay, 19 of 43 analyzed embryos were heterozygous, and in the second experiment, 38 of 66 embryos were heterozygous. These results demonstrate that spermatozoa from the Prm3–/– males are capable of penetrating the zona pellucida and fertilize the oocyte in vitro with similar efficiency of control spermatozoa.

Next, to check if the disruption of the Prm3 gene has any impact on the male fertility, a competitive-breeding experiment was set up. Prm3–/– male and Prm3+/+ males were bred with four wild-type females in a large cage (2 m2) for 17 days. Thereafter, the females were transferred to normal breeding cages and allowed to deliver, and the genotypes of resulting newborns were determined by PCR. This experiment was performed twice, using different males and females in each experiment. One female did not become pregnant, and seven females delivered 92 offspring. Three females produced 32 heterozygous offspring (litter size: 16, 14, 2), all descended from Prm3–/– males, and four females produced 60 wild-type offspring (litter size: 14, 16, 14, 16), all descended from Prm3+/+ males, and no litters contained mixtures of Prm3+/– and Prm3+/+ offspring. The either/or pattern of paternity implies that under these conditions, paternity is determined primarily by precopulatory factors, such as male dominance or female choice, rather than postcopulatory sperm competition within the female reproductive tract.

DISCUSSION

The protamine gene cluster contains four tightly linked genes that are expressed specifically in haploid spermatogenic cells in mammals. The Prm1, Prm2, and Tnp2 genes encode basic chromosomal proteins that function in chromatin remodeling and replacement of histones by protamines. The fourth gene, Prm3, is located between the Prm2 and Tnp2 genes [5, 9] and exhibits both similarities and differences with the other genes in the protamine gene cluster. PRM3 is a small protein, like PRM1, PRM2, and TNP2, and the protein coding sequence is contained in a single exon, unlike the two exons that are present in the other three genes. The properties of PRM3 differ dramatically from those of the basic chromosomal proteins PRM1, PRM2, and TNP2: PRM3 is an acidic protein containing a cluster of glutamic acid residues that is localized in the cytoplasm instead of the nucleus.

The patterns of expression of Prm3 exhibit similarities to Prm1, Prm2, and Tnp2. The Prm3 mRNA is transcribed in early postmeiotic cells from the same strand as the Prm2 and Tnp2 genes [9], but immunocytochemistry and Western blots of staged prepubertal mice demonstrate that PRM3 is detectable only in elongated spermatids. Thus, all four genes in the protamine gene cluster are transcribed in early round spermatids, and productive translation is delayed until elongated spermatids [32]. However, PRM3 is undetectable in epididymis and spermatozoa, implying that the protein, like TNP2, is removed during spermiogenesis. This is different from PRM1 and PRM2, which are retained in mouse sperm.

BLAST searches reveal that the Prm3 gene has not generated gene copies by retroposition, the mechanism by which a reverse transverse transcriptase DNA copy of a processed mRNA is inserted back into genomic DNA, creating a new gene. This supports earlier work using Southern blots demonstrating that a variety of mRNAs that are expressed in meiotic and haploid spermatogenic cells are single copy and therefore have not generated retroposons [22] and BLAST searches demonstrating that the Smcp gene has not created retroposons in four orders of mammals [23]. The genes encoding the somatic and spermatogenic cell-specific isoforms of glyceraldehyde 3' phosphate dehydrogenase provide a striking example of the deficiency of retroposons generated by spermatogenic cell-specific mRNAs: the gene encoding the somatic isoform has generated >200 retroposons, while the gene encoding the spermatogenic cell-specific isoform has generated none [33–35]. The deficit is significant because retroposons are created in the germ line, and the spermatogenic cell-specific mRNAs in this survey include some of the most abundant mRNAs in spermatids, so one might expect that these genes would have created many retroposons. Recently, the deficit in creation of retroposons from spermatogenic cell-specific mRNAs has acquired a mechanism in reports that piRNAs and the piRNA binding protein PIWIL4 (also known as MIWI2) repress retroposons in meiotic and haploid spermatogenic cells, which would be expected to suppress formation of retroposons derived from mRNAs [36]. The suppression of the creation of retroposons is advantageous because retroposons cause deleterious mutations by insertion into essential genes. These observations warrant a systematic examination of the frequency of creation of retroposons from mRNAs that are expressed in somatic cells, female germ cells, and spermatogenic cells in various mammalian genomes.

BLAST searches of the mammalian sequences in the ENSEMBL database reveal that the Prm3 gene encoding a protein with distinctive conserved features is present in 14 species representing seven orders of mammals. The conservation of the Prm3 gene implies that it provides an important function in spermatogenesis. However, the function of PRM3 that underlies the conservation of the gene is unclear. The PRM3 exhibits no significant similarity to any other protein in the NCBI database. Moreover, mammalian proteins containing polyglutamic acid tracts are extremely rare. Interestingly, a polyE sequence is present in the TOX protein, a homeodomain protein with presumed regulatory functions distantly related to members of the Paired/Pax family, which is expressed in mouse testis and ovary [37]. The calspermin gene, which is expressed exclusively in spermatids, encodes a protein with a highly acidic C-terminus that is localized in the cytoplasm [38, 39]. The Prm3 gene may have arisen originally by duplication of one of the protamine genes, and a small cluster of arginine codons, AGG and AGA, was converted into a longer cluster of glutamic acid codons, GAA and GAG, by a frame shift mutation and unequal crossing over, producing a gene with a new function. It is relevant to note that a protamine gene in the tunicate, Styela montereyensis, was created by frame shift mutation in a histone H1 gene [40]. Thus, the Prm3 gene may be one of a small number of genes that evolved originally in mammals.

The prediction of the function of novel genes is particularly difficult in spermatogenesis, a system that is subject to sexual selection on male reproductive success instead of natural selection and that contains many examples of atypical gene expression [31]. To elucidate the role of Prm3, Prm3-deficient mice were produced by homologous recombination. Matings of one Prm3–/– male with one Prm3–/– female revealed that both homozygous mutant males and females were fertile, that the litter sizes were normal, and that there were no obvious morphological defects in the testes and sperm of Prm3-deficient males. However, sperm from Prm3–/– males exhibit significant reductions in sperm motility parameters relative to those of sperm from wild-type males. The PRM3 is not present in the mature sperm, but it contains a putative coiled coil domain, which can indicate a role in protein-protein interaction. One can speculate that lack of this interaction during spermiogenesis has an impact on sperm motility, but this pathway should be studied more intensively to give a more precise answer.

To investigate whether the deficiency of murine PRM3 affects the spermatozoa's ability to fertilize oocytes, we performed the competitive IVF assay. Sperm competition is an evolutionary phenomenon that is caused by the mating of females with multiple males, producing a situation in which the sperm from multiple males competes in the female reproductive tract to fertilize ova [30]. Since sperm motility is thought to be an important factor in sperm competition, we reasoned that the reduced motility of sperm from Prm3–/– males might place them at a disadvantage in competitive IVF with sperm from Prm3+/+ males. Since no difference between wild-type and knockout sperm was observed in IVF assay, we designed a competitive breeding test to determine if the Prm3 disruption results in any mating disadvantage. The sexual selection can act against mutants before copulation (male dominance, mate choice) or after copulation (reduced motility of sperm from Prm3–/– males might result in impairment in their ability to compete with wild-type sperm in the female reproductive tract). Our experimental design included a large cage and cohabitation of the males from birth to suppress male aggressive behavior. The results demonstrated that the progeny from each female were derived from either the Prm3–/– or the Prm3+/+ male and that none of the seven females in these experiments produced offspring derived from both males. Thus, we did not observe promiscuous mating of the females with both males, a prerequisite for sperm competition. Therefore, we can conclude only that no precopulatory selection acts against the mutant males. It should be noted that lack of mixed progeny was not due to the pregnancy block caused by the odor of the male that is not the progenitor, the so-called Bruce effect [41, 42], because the females and rival males were put in the test cage at the same time. Although as far as we are aware sperm competition has never been demonstrated in M. musculus in laboratory conditions, studies of wild populations of a closely related species, Mus domesticus, revealed that ~20% of females produce mixed progeny derived from mating with multiple males [43]. We have also observed multiple inseminations in various mice (genotypes/strains) during competition experiments performed in our animal facility (unpublished data from the authors). Overall, it appears that the disruption of Prm3 affects only the sperm motility, not the ability of the mutant males to mate.

Prm3 resembles a variety of male germ cell-specific genes that exhibit little or no effect on male fertility in gene knockouts, including Theg, Hist1h1t, proacrosin, calgizarrin calspermin, Smcp, Creb3l4, and testatin [39, 44–54]. The observation that targeted deletion of conserved genes that are expressed in spermatogenic cells often has modest effects on male fertility has multiple explanations. One idea is that certain pathways in spermatogenesis are executed by alternative pathways, so that when the function of one gene is disrupted, another gene compensates. However, evolutionary theory provides another perspective. Male fertility is a quantitative genetic trait that is determined by the function of many genes affecting such factors as behavior, body size, odor, and a multitude of processes involved in fertilization in the female reproductive tract [30, 31]. The observation that the Prm3 gene is conserved in diverse orders of mammals provides strong evidence that it is functional because when a gene undergoes duplication, a nonfunctional redundant gene is rapidly lost within a few million years in mammals, a much shorter time than the mammalian adaptive radiation of 80 million years ago [55]. However, because the functions of spermatozoa in fertilization and sperm competition are determined by many genes, the disruption of individual genes produce decreases in male fertility that vary from total loss to marginal decreases that can be detected only by statistical analysis of large numbers of mice. The fact that we are able to observe an effect of the Prm3 gene on motility argues for the importance of the gene in fertility.

ACKNOWLEDGMENTS

We thank M. Schindler and H. Riedesel for their help in the generation and breeding of knockout mice, C. Müller for his help with spermatozoa analysis, and J. Ulrich for excellent technical assistance by IVF. The authors wish also to thank Rick Kesseli for discussions about the evolutionary implications of this work.

FOOTNOTES

1Supported by DFG grants SCHL 523/1-1 and SCHL 523/1-2 to G.S. and NSF grant MCB-0642128 to K.C.K. Back

Correspondence: 2Pawel Grzmil, Institute of Human Genetics, University of Göttingen, Heinrich-Düker-Weg 12, Göttingen D-37073, Germany. FAX: 49 551 399303; e-mail: pgrzmil{at}gwdg.de

3These authors contributed equally to this work. Back

Received: 22 September 2007.

First decision: 18 October 2007.

Accepted: 23 January 2008.

REFERENCES

  1. Meistrich ML. Histone and basic nuclear transitions in mammalian spermatogenesis. In: Hnilica LS, Stein GS, Stein J (eds.), Histones and Others Basic Nuclear Proteins. Boca Raton, FL:: CRC Press; 1989:165–182.
  2. Domenjoud L, Nussbaum G, Adham IM, Greeske G, Engel W. Genomic sequences of human protamines whose genes, PRM1 and PRM2, are clustered. Genomics 1990; 8:127–133.[CrossRef][Medline]
  3. Engel W, Keime S, Kremling H, Hameister H, Schluter G. The genes for protamine 1 and 2 (PRM1 and PRM2) and transition protein 2 (TNP2) are closely linked in the mammalian genome. Cytogenet Cell Genet 1992; 61:158–159.[CrossRef][Medline]
  4. Nelson JE, Krawetz SA. Linkage of human spermatid-specific basic nuclear protein genes. Definition and evolution of the P1->P2->TP2 locus. J Biol Chem 1993; 268:2932–2936.[Abstract/Free Full Text]
  5. Schluter G, Celik A, Obata R, Schlicker M, Hofferbert S, Schlung A, Adham IM, Engel W. Sequence analysis of the conserved protamine gene cluster shows that it contains a fourth expressed gene. Mol Reprod Dev 1996; 43:1–6.[CrossRef][Medline]
  6. Schluter G, Kremling H, Engel W. The gene for human transition protein 2: nucleotide sequence, assignment to the protamine gene cluster, and evidence for its low expression. Genomics 1992; 14:377–383.[CrossRef][Medline]
  7. Kleene KC. Poly(A) shortening accompanies the activation of translation of five mRNAs during spermiogenesis in the mouse. Development 1989; 106:367–373.[Abstract]
  8. Cho C, Willis WD, Goulding EH, Jung-Ha H, Choi YC, Hecht NB, Eddy EM. Haploinsufficiency of protamine-1 or –2 causes infertility in mice. Nat Genet 2001; 28:82–86.[CrossRef][Medline]
  9. Schluter G, Engel W. The rat Prm3 gene is an intronless member of the protamine gene cluster and is expressed in haploid male germ cells. Cytogenet Cell Genet 1995; 71:352–355.[Medline]
  10. Adham IM, Nayernia K, Burkhardt-Gottges E, Topaloglu O, Dixkens C, Holstein AF, Engel W. Teratozoospermia in mice lacking the transition protein 2 (Tnp2). Mol Hum Reprod 2001; 7:513–520.[Abstract/Free Full Text]
  11. Kleene KC, Distel RJ, Hecht NB. Nucleotide sequence of a cDNA clone encoding mouse protamine 1. Biochemistry 1985; 24:719–722.[CrossRef][Medline]
  12. Rapp G, Klaudiny J, Hagendorff G, Luck MR, Scheit KH. Complete sequence of the coding region of human elongation factor 2 (EF-2) by enzymatic amplification of cDNA from human ovarian granulosa cells. Biol Chem Hoppe Seyler 1989; 370:1071–1075.[Medline]
  13. Gorg A, Boguth G, Obermaier C, Posch A, Weiss W. Two-dimensional polyacrylamide gel electrophoresis with immobilized pH gradients in the first dimension (IPG-Dalt): the state of the art and the controversy of vertical versus horizontal systems. Electrophoresis 1995; 16:1079–1086.[CrossRef][Medline]
  14. Nayernia K, Diaconu M, Aumuller G, Wennemuth G, Schwandt I, Kleene K, Kuehn H, Engel W. Phospholipid hydroperoxide glutathione peroxidase: expression pattern during testicular development in mouse and evolutionary conservation in spermatozoa. Mol Reprod Dev 2004; 67:458–464.[CrossRef][Medline]
  15. Rosahl TW, Spillane D, Missler M, Herz J, Selig DK, Wolff JR, Hammer RE, Malenka RC, Sudhof TC. Essential functions of synapsins I and II in synaptic vesicle regulation. Nature 1995; 375:488–493.[CrossRef][Medline]
  16. Joyner AL. Gene Targeting: A Practical Approach. Oxford:: IRL Press; 1993.
  17. Nayernia K, Adham IM, Burkhardt-Gottges E, Neesen J, Rieche M, Wolf S, Sancken U, Kleene K, Engel W. Asthenozoospermia in mice with targeted deletion of the sperm mitochondrion-associated cysteine-rich protein (Smcp) gene. Mol Cell Biol 2002; 22:3046–3052.[Abstract/Free Full Text]
  18. Nayernia K, Drabent B, Adham IM, Möschner M, Wolf S, Meinhardt A, Engel W. Male mice lacking three germ cell expressed genes are fertile. Biol Reprod 2003; 69:1973–1978.[Abstract/Free Full Text]
  19. Schultz J, Milpetz F, Bork P, Ponting CP. SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 1998 95 5857–5864.
  20. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215:403–410.[CrossRef][Medline]
  21. Vanin EF. Processed pseudogenes: characteristics and evolution. Annu Rev Genet 1985; 19:253–272.[CrossRef][Medline]
  22. Zhong X, Kleene KC. cDNA copies of the testis-specific lactate dehydrogenase (LDH-C) mRNA are present in spermatogenic cells in mice, but processed pseudogenes are not derived from mRNAs that are expressed in haploid and late meiotic spermatogenic cells. Mamm Genome 1999; 10:6–12.[CrossRef][Medline]
  23. Hawthorne SK, Goodarzi GT, Bagarova J, Gallant KE, Busanelli RR, Olend W, Kleene KC. Comparative genomics of the sperm-mitochondria associated cysteine-rich protein gene. Genomics 2006; 87:282–391.
  24. Hecht NB, Penshow JD. In situ localization of mRNAs coding for mouse testicular structural genes. Exp Cell Res 1987; 173:274–281.[CrossRef][Medline]
  25. Hecht NB. Regulation of "haploid expressed genes" in male germ cells. J Reprod Fertil 1990; 88:679–693.[Abstract/Free Full Text]
  26. Bellvé AR, Cavicchia JC, Millette CF, O'Brien DA, Bhatnager YM, Dym M. Spermatogenic cells of the prepubertal mouse: isolation and morphological characterization. J Cell Biol 1977; 74:68–85.[Abstract/Free Full Text]
  27. Lyon MF, Searle AG. Genetic Variants and Strains of the Laboratory Mouse, 2nd ed. Oxford:: Oxford University Press; 1989.
  28. Chubb C. Oligotriche and quaking gene mutations: phenotypic effects on mouse spermatogenesis and testicular steroidogenesis. J Androl 1992; 13:312–317.[Abstract/Free Full Text]
  29. Neill JM, Olds-Clarke P. A computer-assisted assay for mouse sperm hyperactivation demonstrates that bicarbonate but not bovine serum albumin is required. Gamete Res 1987; 18:121–140.[CrossRef][Medline]
  30. Birkhead TR. Promiscuity: An Evolutionary History of Sperm Competition. Cambridge, MA:: Harvard University Press; 2001.
  31. Kleene KC. Sexual selection, genetic conflict, selfish genes and the atypical patterns of gene expression in spermatogenic cells. Dev Biol 2005; 277:16–26.[CrossRef][Medline]
  32. Kleene KC. Patterns of translational regulation in the mammalian testis. Mol Reprod Dev 1996; 43:268–281.[CrossRef][Medline]
  33. Piechaczyk M, Blanchard JM, Riaad El-Sabaty A, Marty L, Jeanteur P. Unusual abundance of vertebrate 3-phosphate dehydrogenase pseudogenes. Nature 1984; 312:469–471.[CrossRef][Medline]
  34. Welch JE, Brown PR, O'Brien DA, Eddy EM. Genomic organization of a mouse glyceraldehyde 3-phosphate dehydrogenase gene (Gapd-s) expressed in post-meiotic spermatogenic cells. Dev Genet 1995; 16:179–189.[CrossRef][Medline]
  35. Rat Genome Sequencing Consortium. Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature 2004; 428:493–521.[CrossRef][Medline]
  36. Carmell MA, Girard A, van de Kant HJ, Bour'chis D, Bestor TH, de Rooij DG, Hannon GJ. MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell 2007; 2:503–514.
  37. Kang YL, Li H, Chen WH, Tzeng YS, Lai YL, Hsieh-Li HM. A novel PEPP homeobox gene, TOX, is highly glutamic acid rich and specifically expressed in murine testis and ovary. Biol Reprod 2004; 70:828–836.[Abstract/Free Full Text]
  38. Wu JY, Means AR. Ca21/calmodulin-dependent protein kinase IV is expressed in spermatids and targeted to chromatin and the nuclear matrix. J Biol Chem 2000; 275:7994–7999.[Abstract/Free Full Text]
  39. Wu JY, Ribar TJ, Means AR. Spermatogenesis and the regulation of Ca(2+)-calmodulin-dependent protein kinase IV localization are not dependent on calspermin. Mol Cell Biol 2001; 21:6066–6070.[Abstract/Free Full Text]
  40. Lewis JD, Saperas N, Song Y, Zamora MJ, Chiva M, Ausio J. Histone H1 and the origin of protamines. Proc Natl Acad Sci U S A 2004; 101:4148–4152.[Abstract/Free Full Text]
  41. Bruce HM. Exteroceptive block to pregnancy in the mouse. Nature 1959; 184:105.[CrossRef][Medline]
  42. Bruce HM. Absence of pregnancy-block in mice when stud and test males belong to an inbred strain. J Reprod Fertil 1968; 17:407–408.[Abstract/Free Full Text]
  43. Dean MD, Ardlie KG, Nachman MW. The frequency of multiple paternity suggests that sperm competition is common in house mice (Mus domesticus). Mol Ecol 2006; 15:4141–4151.[CrossRef][Medline]
  44. Mannan AU, Nayernia K, Mueller C, Burfeind P, Adham IM, Engel W. Male mice lacking the Theg (testicular haploid expressed gene) protein undergo normal spermatogenesis and are fertile. Biol Reprod 2003; 69:788–796.[Abstract/Free Full Text]
  45. Drabent B, Saftig P, Bode C, Doenecke D. Spermatogenesis proceeds normally in mice without linker histone H1t. Histochem Cell Biol 2000; 113:433–442.[Medline]
  46. Baba T, Azuma S, Kashiwabara S, Toyoda Y. Sperm from mice carrying a targeted mutation of the acrosin gene can penetrate the oocyte zona pellucida and effect fertilization. J Biol Chem 1994; 16:31845–31849.
  47. Adham IM, Nayernia K, Engel W. Spermatozoa lacking acrosin protein show delayed fertilization. Mol Reprod Dev 1997; 46:370–376.[CrossRef][Medline]
  48. Fantz DA, Hatfield WR, Horvath G, Kistler MK, Kistler WS. Mice with a targeted disruption of the H1t gene are fertile and undergo normal changes in structural chromosomal proteins during spermiogenesis. Biol Rep 2001; 64:425–431.[Abstract/Free Full Text]
  49. Nayernia K, Adham IM, Shamsadin R, Müller C, Sancken U, Engel W. Proacrosin-deficient mice and zona pellucida modifications in an experimental model of multifactorial infertility. Mol Hum Reprod 2002; 8:434–440.[Abstract/Free Full Text]
  50. Mannan AU, Nica G, Nayernia K, Mueller C, Engel W. Calgizarrin like gene (Cal) deficient mice undergo normal spermatogenesis. Mol Reprod Dev 2003; 66:431–438.[CrossRef][Medline]
  51. Dev A, Nayernia K, Meins M, Adham I, Lacone F, Engel W. Mice deficient for RNA-binding protein brunol1 show reduction of spermatogenesis but are fertile. Mol Reprod Dev 2007; 74:1456–1464.[CrossRef][Medline]
  52. Adham IM, Eck TJ, Mierau K, Muller N, Sallam MA, Paprotta I, Schubert S, Hoyer-Fender S, Engel W. Reduction of spermatogenesis but not fertility in Creb3l4-deficient mice. Mol Cell Biol 2005; 25:7657–7664.[Abstract/Free Full Text]
  53. Tohonen V, Frygelius J, Mohammadieh M, Kvist U, Pelliniemi LJ, O'Brien K, Nordqvist K, Wedell A. Normal sexual development and fertility in testatin knockout mice. Mol Cell Biol 2005; 25:4892–4902.[Abstract/Free Full Text]
  54. Hasegawa K, Chuma S, Tada T, Sakurai T, Tamura M, Suemori H, Nakatsuji N. Testatin transgenic and knockout mice exhibit normal sex-differentiation. Biochem Biophys Res Commun 2006; 341:369–375.[CrossRef][Medline]
  55. Lynch M, Conery JS. The evolutionary fate and consequences of duplicate genes. Science 2000; 290:1151–1155.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Tables
Right arrow All Versions of this Article:
78/6/958    most recent
biolreprod.107.065706v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grzmil, P.
Right arrow Articles by Engel, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grzmil, P.
Right arrow Articles by Engel, W.
Agricola
Right arrow Articles by Grzmil, P.
Right arrow Articles by Engel, W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS