| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Testis; |
Center for Research on Reproduction and Women's Health,3 University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6080
Life Sciences Division,4 Oak Ridge National Laboratory, Oak Ridge, Tennessee 37830-6942
Department of Molecular Biosciences,5 Washington State University, Pullman, Washington 99164-4660
ABSTRACT
The mammalian testis expresses a class of small noncoding RNAs that interact with mammalian PIWI proteins. In mice, the PIWI-interacting RNAs (piRNAs) partner with mammalian PIWI proteins, PIWIL1 and PIWIL2, also known as MIWI and MILI, to maintain transposon silencing in the germline genome. Here, we demonstrate that inactivation of Nct1/2, two noncoding RNAs encoding piRNAs, leads to derepression of LINE-1 (L1) but does not affect mouse viability, spermatogenesis, testicular gene expression, or fertility. These findings indicate that piRNAs from a cluster on chromosome 2 are necessary to maintain transposon silencing.
gametogenesis, gene regulation, male reproductive tract, piRNA, spermatogenesis, testis, transposon
The mammalian germline expresses a class of small RNAs (26–31 nucleotides) that interact with Piwi family proteins and are called piRNAs [1–4]. Similar small RNAs are also found in Drosophila and zebrafish [5–8]. Different from siRNAs and microRNAs, which are generated from double-stranded and short-hairpin RNA precursors by a Dicer-dependent pathway, piRNAs are produced by a yet-to-be-described Dicer-independent mechanism [6, 7]. Piwi-interacting RNAs are transcribed from genomic clusters whose locations are evolutionarily conserved in mammals, although the sequences of individual piRNAs are not. Although the precise functions of piRNAs in germ cells are unknown, they may play a role in chromatin organization, transcriptional control, or posttranscriptional control [9]. Because some piRNAs are derived from genomic annotated repeat sequences, including transposons and retrotransposons, one proposed function of piRNAs in association with Piwi proteins is to maintain transposon silencing [1, 2, 9–11]. Three members of the Piwi-family in the mouse, Piwil1, Piwil2, and Piwil4 (Miwi2), are required for spermatogenesis [12–14]. In Drosophila, RasiRNAs (repeat-associated small interfering RNAs, the Drosophila equivalent of piRNAs) are highly enriched for sequences that target repetitive elements and function in a transposon surveillance pathway [6, 15, 16]. In zebrafish, many piRNAs are derived from transposons and help silence repetitive elements [7]. In the mouse, complexes of PIWIL4 or PIWIL2 and piRNAs are essential for the repression of transposons, and some mouse piRNAs map to transposon and retrotransposon repeats [10, 14]. Long interspersed element-1 (LINE-1, L1) and intracisternal A particles (IAP) are derepressed in Piwil2 and Piwil4 mutants, indicating that these RNA-binding proteins are required to regulate transposon expression in the mammalian germline [9, 10, 14, 17].
We recently identified two noncoding RNAs, Nct1 and Nct2, that are transiently expressed in meiotic male mouse germ cells and encode piRNAs from one cluster on chromosome 2, leading us to propose that Nct1/2 is part of a large, rapidly processed piRNA-containing transcript(s) [2, 3, 18, 19] (Fig. 1B). Here, we demonstrate derepression of L1 in mouse testes with an inactivating mutation of Nct1/2. Mice lacking Nct1/2 have increased levels of L1 mRNA and the L1 protein, open reading frame 1 (ORF1), indicating an essential role for piRNAs in retroposon silencing in mammals.
|
All investigations were conducted in accordance with the guide for Care and Use of Laboratory Animals (1966), and the Institutional Animal Care and Use Committee of the University of Pennsylvania approved all procedures involving animals in advance. To delete the Nct1/2 genomic locus in the hybrid mouse embryonic stem (ES) cell line EC7.1 (C57BL/6J x 129X1/SvJ) [20], a bacterial artificial chromosome (BAC)-based gene targeting vector (BAC vector) was used (Fig. 1A). The BAC vector was constructed using a modified recombineering procedure previously described [21]. All reagents used for the recombineering were obtained from the National Institutes of Health (http://recombineering.ncifcrf.gov/) unless specified otherwise. BAC clone RP23-290O15, which carries the Nct1/2 locus from C57BL/6J DNA, was obtained from Children's Hospital Oakland Research Institute (http://bacpac.chori.org/). Briefly, two 70-nucleotide oligomers (Nct1&2del-L: GAGGGCGCCCTTCCTCGACTGCCTGCTTTCTCATATTTTTCGGTGGCCCAATTCCGATCATATTC; and Nct1&2del-R: TTAGTCACGTGTTAAATGACAGGAAGGGAGACATGTAGAGGGTGTATATGGCCGCTCTAGAACTAGTGGA), which have their first 50 nucleotides of homology flanking the Nct1/2 genomic DNA followed by 20 nucleotides that bracket the selectable Neo gene on the plasmid pL452, were synthesized and used as PCR primers, with the pL452 plasmid as template. The Expand High Fidelity Kit (3300242; Roche) was used for PCR to minimize PCR errors. The PCR product was treated with the enzyme DpnI to release the insert and after electrophoresis in an agarose gel purified with a Qiagen gel extraction kit. The DNA was resuspended in water, electroporated into recombineering-ready RP23-290O15, which contains the mini-lambda (tet), and heat shocked at 42°C for 15 min. After electroporation, the bacteria were grown at 32°C in low-salt LB agar plates containing cam (20 mg/ml) and kan (25 mg/ml) to select clones. The next day, the correct BAC vectors were identified by PCR and confirmed by restriction digestion and sequencing. The BAC vector DNA was prepared using a Nucleobond BAC Maxi kit (Clontech) in preparation for electroporation into the ES cell line [22]. Homologous recombination in the ES cells was screened by the loss of native allele method [23] using a TaqMan assay (Applied Biosystems). Targeted ES cell lines were further confirmed by fluorescent in situ hybridization using the BAC vector as probe [20]. Germline transmission was achieved from ES cell clones.
DNA was extracted using the PUREGENE DNA extraction kit (Gentra, Minneapolis, MN) from mouse ear snips and genotyped by PCR (primer set: Nct1&2-L: CTTTAGGGTATGCATCTTTGGACT; Nct1&2-R2: TCACTTTTCGAAGGTCTATCCTCT; Nct1&2-R2: CGGTAGAATTTCGACGACCT). Gene-targeted mice contain a 546-nucleotide PCR amplification in place of the 659-nucleotide fragment in wild-type mice (Fig. 1A). The target (546 bp) and the wild-type (659 bp) sequences were amplified in 25-µl reactions containing genomic DNA template, primers, and Pure Taq Ready-To-Go PCR Beads (GE Healthcare). The PCR amplification was as follows: an initial denaturation step at 94°C for 5 min, followed by 35 amplification cycles: 35 sec at 94°C; 35 sec at 55°C; and 35 sec at 72°C, followed by a final extension step at 72°C for 3 min. The PCR products were separated on 1.5% agarose gels and visualized by ethidium bromide staining. The targeted mice have been assigned the symbols Nct1tm1Nbh and Nct2tm1Nbh.
For piRNA blots, total RNA was extracted from adult mouse testes using Trizol (Invitrogen), and 30-µg samples were electrophoresed in 15% denaturing PAGE gels and transferred to Hybond-N+ membranes (Amersham Biosciences). DNA oligonucleotides (Integrated DNA Technologies) complementary to piRNA sequences were labeled with [32P]
-ATP with T4 polynucleotide kinase, and hybridizations were performed at 42°C in Ultrahyb-Oligo Hybridization Buffer (Ambion).
To detect low-abundance piRNAs (the piRNAs from L1 related repeat sequences, piR-111581, 140936, and 18121), an enrichment isolation procedure for small RNAs and crosslinking was employed [24]. Small RNAs (10 µg) were isolated with the mirVana miRNA isolation kit (Ambion) and electrophoresed in 15% denaturing PAGE gels (MOPS/NaOH buffer). After transfer to Hybond-NX membranes (Amersham Biosciences), the RNAs were fixed to membranes by carbodiimide-mediated crosslinking. Hybridizations were performed as described above. To strip probes, membranes were boiled in 0.1% SDS and 5 mM EDTA for 5 min and then re-exposed to monitor probe removal.
For L1 Northern blots, total testicular RNAs (10 µg) were electrophoresed in 1% agarose-formaldehyde gels and transferred to Hybond-N+ membranes (Amersham Biosciences) in alkaline buffer. The [32P]-labeled specific probes for detecting L1 sense strands were generated after in vitro transcription of a PCR product of the 5' UTR of L1 (M13002) in PCRII-TOPO vector. The probe for β-actin was labeled using Ready-to-go DNA labeling beads (Amersham Biosciences), and hybridizations were performed in Ultrahyb buffer (Ambion).
RT-PCR and Semiquantitative PCR Assays
Messenger RNAs purified from total testis RNA using the Dynabeads mRNA purification kit (Invitrogen) or total testis RNA were reverse transcribed using Superscript III reverse transcriptase (Invitrogen) with random hexamers. Real-time PCR was performed with SYBR Green PCR master mix (Applied Biosystems) on the Applied Biosystems 7900HT system using primers for Nct1/2, L1, and β-actin (Nct1/2-F: AGGCAAGTCCTAGATCTCAGAGCA; Nct1/2-R: TTGTCAACACAGAGGCAAGGCAAC; L1-5UTR-F: GGCGAAAGGCAAACGTAAGA; L1-5UTR-R: GGAGTGCTGCGTTCTGATGA; actin-F:CGGTTCCGATGCCCTGAGGCTCTT; actin-R: GTCACACTTCATGATGGAATTGA). At least two animals of each genotype were examined.
Total RNA was isolated using Trizol (Invitrogen) from null or wild-type mice for quantitative microarray analyses. Three independent samples were analyzed three times each. Affymetrix mouse GeneChip MOE430A microarrays (Affymetrix) were hybridized at the Microarray Facility of the Washington State University as previously reported [25]. Following hybridization, washing, and staining with streptavidin-phycoerythrin, a confocal scanner was used to collect fluorescence signal at 3-µm resolution after excitation at 570 nm. Affymetrix GCOS 1.2 software was used to quantify the hybridized arrays. Affymetrix's MAS5 algorithm (with default settings, as encoded in GCOS 1.2) was used to generate signal values and to determine present/absent/marginal flags for each probe set on each array. Probe sets flagged by MAS5 as present are described as detected.
Western Blotting and Immunohistochemistry Protocols
For Western blotting, total testis extracts were prepared as previously described [26]. Proteins were electrophoresed in 10% SDS-PAGE gels, transferred to nitrocellulose membranes, and incubated overnight at 4°C in PBS buffer containing 5% nonfat milk. Mouse L1 OFR1 protein was detected with polyclonal anti-ORF1 (1:10 000; a gift from Dr. S. L. Martin). Blots were stripped and reprobed using anti-mouse IAP (GAG) protein (1:3000; a gift from Dr. B. R. Cullen), or anti-PIWIL1 (1:3000; a gift from Dr. H. Lin). Actin expression levels were determined with a monoclonal antibody (Sigma, 1:10 000) to monitor protein loading and retention.
Testes from adult mice were fixed in Bouin solution for 4 h, embedded in paraffin, and sectioned at 6 µm. For general staining, sections were stained with hematoxylin and eosin. For immunohistochemistry, sections were rehydrated and treated with 0.3% hydrogen peroxide for 30 min. Slides were incubated in 5% milk in PBS for 1 h and then with L1 ORF1 antibody (1:500) or rabbit IgG for 16 h at 4°C. The Elite Vectastain ABC kit (Vector Laboratories) was used for detection following the manufacturer's instructions. Sections were counterstained with Mayer hematoxylin before dehydration and mounting in Permount (Fisher).
Mutation of Nct1/2 Does Not Affect Reproduction
Mice lacking Nct1/2 were generated by homologous recombination using a BAC-based gene targeting vector (Fig. 1A). Targeted ES cell lines were microinjected into blastocysts, and the chimeras were bred to generate mutant mice. Mice were genotyped by PCR (please see Supplemental Fig. 1 available online at www.biolreprod.org). Confirming the deletion, Nct1/2 was not detectable by real-time PCR in RNA from the testes of null mice (data not shown). Mice heterozygous or homozygous for the Nct1/2 deletion grew to adulthood, were of normal size and weight, and were physically indistinguishable from their wild-type littermates. Both male and female homozygotes (22 male and female homozygotes were examined) were fertile, and when mated produced mean litter sizes of 8 ± 2 pups, similarly to their wild-type littermates (mean litter sizes of 8 ± 3 pups). Hematoxylin staining of testis sections from adult wild-type and Nct1/2-deficient mice revealed normal spermatogenesis (Supplemental Fig. 1 available online at www.biolreprod.org). Moreover, microarray analyses of testis transcripts from wild-type and Nct1/2-deficient mice with Affymetrix Gene Chip MOE430A revealed no significant changes in gene expression (Supplemental Table 1 available online at www.biolreprod.org). Using a 2-fold difference and raw data value of 100 as cutoff points, 14 probe sets were upregulated or downregulated. This minimal change in gene expression is consistent with the normal spermatogenesis and normal fertility seen with the gene-targeted mice, indicating that the inactivation of the Nct1/2 cluster of piRNAs does not have a detectable effect on the spermatogenic cycle.
Piwi-Interacting RNA Expression Is Affected by Mutation of the Nct1/2 Region
While we were creating the Nct1/2-deficient mice, mammalian piRNAs were discovered [1–4]. Examining the piRNA online databases (National Center for Biotechnology Information [NCBI] database) [27], we realized the Nct1/2 transcripts (of 
0.7 and 0.8 kb) [18, 19] map within one of several piRNA clusters in chromosome 2, and the targeted 1.9-kb region encoded numerous single-copy piRNAs (Fig. 1). Although the lengths of the primary transcripts of testicular piRNAs are not known, large precursor RNAs in the size range of 30–90 kb have been proposed [1–4]. Knowing that the insertion of a Pgk-Neo cassette can lead to position effects on neighboring genes and interfere with processing of targeted transcripts [28, 29], we hypothesized that the insertion of a Pgk-Neo cassette would affect the transcription or processing of the putative piRNA precursor(s), thereby maximizing the number of piRNAs affected.
To determine the extent of the insertion's effect on piRNA levels both within and external to the deletion, RNA preparations were purified from the testes of null mice and their littermate wild-type controls and analyzed by Northern blotting (Fig. 2). As expected for a DNA deletion, a very abundant single-copy piRNA encoded within the 1.9-kb deleted region of chromosome 2, gsRNA10 (piR-108205, –9097) [19], was not detectable in mice lacking Nct1/2 (Fig. 2B, second row). In addition, piRNAs up to 7 kb upstream (piR-135965) and 8 kb downstream of the deleted region (piR-111581) were markedly decreased in the male null mice (Fig. 2A, upper bracket). Interestingly, piR-111581 is in an L1 related repeat sequence complementary to the 3' UTR of one L1 repeat sequence (M13002), making this piRNA antisense to a subset of L1 retrotransposons (Fig. 2A) [27]. Two piRNAs, piR-121670 and piRNA-9163—which map 8 kb upstream of the deleted region and are transcribed antisense—and four piRNAs downstream to piR-111581 (piR-140936, piR-7134, piR-105334, and piR-125025) were not reduced in gene-targeted mice, limiting the effect of the insertion to an 17.5-kb region (Fig. 2). Moreover, similar levels of piR-113566, encoded in a different piRNA cluster on chromosome 2 [2, 3], and piR-1 [2], encoded on chromosome 9, were seen in gene-targeted and wild-type control mice (Fig. 2B). We do not know whether the selective reductions in piRNA levels in mice lacking Nct1/2 result from altered transcription or precursor processing deficiencies, or whether the loss of deleted piRNAs affects the synthesis/stabilization of other piRNAs. Based upon the normal levels of piRNAs in other clusters, we believe that these decreases are specific to the region around Nct1/2.
|
Because we have randomly chosen a group of single-copy piRNAs, and the 10 piRNAs examined in the 17.5 kb region all show reduced levels in null mice, our mapping by Northern blotting suggests that the Pgk-Neo cassette insertion allows us to assess a phenotype in fertile mice in a genomic region of chromosome 2 containing more than 500 known piRNAs [27]. We believe that this insertion phenocopies a null specifically for this region of chromosome 2, because 1) microarray analyses (Supplemental Table 1 available online at www.biolreprod.org) reveal few, if any, effects on overall gene expression in the testis; 2) no changes are seen in PIWIL1 level (Fig. 3C), which is crucial for piRNA expression; 3) spermatogenesis and fertility are normal; 4) the expression of intact piRNAs (at reduced amounts) from sites surrounding the 1.9-kb deletion suggest no DNA deletions or rearrangements; and 5) the expression levels of the two closest bracketing open reading frames—Golgi GDP-fucose transporter (Slc35c1) and carbohydrate sulfotransferase 1 (Chst1), 80 and 50 kb away, respectively (NCBI database)—are unchanged in the microarrays (Slc35c1 is not essential for spermatogenesis [30], whereas Chst1 expression is undetectable in germ cells).
|
Piwi-Interacting RNAs Are Involved in Transposon Control
Piwil4- or Piwil2-deficient male mice are infertile and exhibit a phenotype indicative of inappropriate activation of the transposable element L1 in the germline [10, 14]. Many L1 insertions are truncated, rearranged, or mutated, leading to a heterogeneous population of L1 transcripts [31]. In light of the reduced amounts of the piRNA complementary to the 3' UTR of the L1 retrotransposon (piR-111581; Fig. 2), we investigated whether L1 transposons are upregulated in the Nct1/2-null mice (Fig. 3A). As previously reported for L1 hybridizations with adult mouse testis RNA [32, 33], a 7-kb mRNA was detected (Fig. 3A, arrow). The amount of this mRNA was increased in the testes of null mice, indicating that full-length L1 transcripts are selectively derepressed in null mice. Quantitative RT-PCR assays with primers directed to the 5' UTR confirmed the modest, but reproducible, increase in the L1 mRNA seen with the Northern blots in the mutants (Fig. 3, A and B).
Functional L1 transcripts encode two open reading frames (ORFs 1 and 2) [31]. ORF1 encodes an RNA-binding protein that forms high-affinity ribonucleoprotein complexes with L1 RNA, and ORF2 encodes an endonuclease and a reverse transcriptase [33, 34]. To determine whether the increases in the upregulated L1 RNAs in null mice (Fig. 3, A and B) lead to increases in an encoded retrotransposition protein, Western blotting of total testicular lysates from several different adult wild-type and null mice was performed with antibodies against ORF1 (Fig. 3C). Compared with littermate controls, increases in ORF1 up to 15-fold were routinely detected in null mice. The higher levels of ORF1 protein reflect the upregulated amounts of L1 RNA we detected in null mice (Fig. 3, A and B). This increase is not a result of insertion of the Pgk promoter into an L1 element, because there are no L1 ORF sequences in or near the 17.5-kb region. The reduced levels of piRNA from the L1-related sequence (Fig. 2) may contribute to the selective derepression of ORF1. We did not find increased ORF1 protein levels in several somatic tissues (brain, lung, and spleen) from null mice, suggesting that the L1 upregulation results from the reduced amounts of piRNAs in the testes of the null mice (data not shown). Efforts to measure ORF2 were not successful because, unlike ORF1, translation of ORF2 is often suppressed and difficult to detect in most tissues and cell lines, even when it is overexpressed [31, 34].
Piwil4- or Piwil2-null mice derepress L1 as well as another active transposon element, IAP [10, 14]. We did not detect an increase in Iap mRNA or protein in the testes of Nct1/2-null mice, suggesting that the deletion/reduction of a small group of chromosome 2-encoded piRNAs has a more limited effect on derepressing retransposons than the Piwil4 or Piwil2 mutants (Fig. 3 and data not shown). Moreover, we did not detect any Iap-related piRNAs within the 17.5-kb region.
ORF1 protein is expressed at low levels in several somatic and germ cell types in the testes of adult mice [32, 33]. Although transposition may occur in any cell type, expression in meiotic stage germ cells concomitant with strand breakage during recombination would allow L1 insertion into new chromosomal locations. To determine the sites of increased ORF1 expression in testes of Nct1/2-null mice, we used immunohistochemistry to localize ORF1 (Fig. 4). As reported previously [33], discrete dots of small amounts of ORF1 immunoreactivity were found in round spermatids and were associated with elongating spermatids in adult wild-type mice (Fig. 4, A and C). Consistent with the increased L1 RNA and protein levels in mutant mice (Fig. 3), stronger staining for ORF1 was seen in testis sections from mutant mice (Fig. 4, B and D). Remarkably, ORF1 is selectively expressed in the mutant mice at high levels in early-pachytene and midpachytene spermatocytes, the cells in the testis that offer optimal opportunity for L1 insertion [33].
|
Piwi-interacting RNAs are proposed to have many functions in the male germline, including repression of transposons, regulation of translation, and targeting of regions of the genome for epigenetic change [8–11, 15–17, 35, 36]. PIWI-family proteins are believed to be involved in the processing and stabilization of piRNAs [16, 37]. Mutation of murine Piwi-family proteins disrupts spermatogenesis, implicating these proteins in association with their piRNA partners in transposon control. Here, we demonstrate that deletion/reduction of a small number of piRNAs leads to a dramatic increase in the retrotransposition protein ORF1 without affecting spermatogenesis, fertility, or phenotype. Similarly, overexpression of a human active L1 gene in mice also does not affect spermatogenesis [38]. Our findings are complementary to and support the activation of transposable elements seen when Piwil4 or Piwil2 are deleted [10, 14]. In these mutants, spermatogenic arrest also occurs, suggesting additional functions for these RNA-binding proteins or a more dramatic effect from the loss of the majority (all?) of the piRNAs.
Although the Argonaute proteins PIWI, Aubergine, and Argonaute 3 have been proposed to be involved in the processing of piRNAs in Drosophila [16, 37], the specific mechanism producing piRNAs in mammals remains unclear [9, 10]. In Drosophila, a "ping-pong" model has been suggested to accelerate the processing of piRNAs from precursors [16, 37]. This model allows the active transposon transcripts and piRNA clusters to participate in a slicer-dependent loop by sequence complementarity, leading to the degradation of transposon mRNA and amplification of the gene silencing pathways [16, 37]. A similar mechanism involving PIWIL2 and piRNAs has been presented for transposon control in mammals, based upon the existence of transposon sequences in both strands of genomic DNA [10]. Here, we find that deletion of the Nct1/2 region leads to reduced levels of many piRNAs, including an antisense L1-related repeat sequence piRNA. We speculate that impaired expression of piRNAs (from the antisense strand of L1, such as piR-111581; Fig. 2B) may affect the normal cycling of the slicer-dependent loop, leading to reduced levels of piRNAs from the sense strand of L1 (such as piR-18121; Fig. 2B) and increased ORF1. Considering the sequence variations among the many L1-related sequences [31], there are likely to be multiple processing cycles, with piR-111581 only affecting a few of them.
In the meiotic germ cells of mammals, transposable elements are tightly controlled, and selective CpG methylation is believed to contribute to the long-term silencing of retrotransposons [31, 39–41]. In the testis following the deletion of the DNA methyltransferase 3-like (Dnmt3l) gene, an overexpression of long-terminal repeat (LTR) and non-LTR retrotransposons in spermatogonia and spermatocytes was detected [42]. In Piwil4- or Piwil2-null mice, the transcription of transposon elements is markedly increased, suggesting that piRNAs may guide the methylation of transposon elements [10, 14]. In contrast, in the Nct1/2-null mice, we did not find a major increase of the L1 element RNA (Fig. 3, A and B). However, the L1-encoded protein ORF1 was markedly increased (up to 15-fold). This increased ORF1 expression was not random throughout the testis, but was predominately in early-pachytene and midpachytene spermatocytes, suggesting that transposon control is disregulated in cells highly susceptible to genomic insertions. The small increase in L1 mRNA and large increase in ORF1 suggest there may be posttranscriptional regulation. We propose that piRNA-protein complexes play a role in translation control, as seen with microRNAs [43]. Indeed, the polysomal association of PIWIL1-piRNA complexes supports their involvement with translation [4].
In summary, we find that the loss of a small cluster of piRNAs leads to transposon activation in the germline without impairing spermatogenesis. Considering the small number (hundreds) of piRNAs in the region of chromosome 2 we disrupted compared with the currently estimated >100 000 testicular piRNAs (20% are from repeat sequences; NCBI database), the upregulation of ORF1 is quite remarkable and suggests important roles for piRNAs in the control of L1 retrotransposons (Fig. 2). Ongoing experiments will investigate whether deletion of other piRNAs can activate transposon elements. The mechanism(s) whereby ribonucleoprotein complexes of RNA-binding proteins and piRNAs protect our genome await discovery.
ACKNOWLEDGMENTS
We thank Dr. B. R. Cullen for anti-IAP (GAG), Dr. H. Lin for anti-PIWIL1, and Dr. S. L. Martin for anti-L1 (ORF1), and Drs. M. A. Handel and G. Gerton for help with the staging of the mutant seminiferous tubules.
FOOTNOTES
1Supported by National Institutes of Health grant HD 28832. 
Correspondence: 2Norman B. Hecht, Center for Research on Reproduction and Women's Health, University of Pennsylvania School of Medicine, 1310 Biomedical Research Building, 421 Curie Blvd., Philadelphia, PA 19104-6080. FAX: 215 573 7627; e-mail: nhecht{at}mail.med.upenn.edu
Received: 31 January 2008.
First decision: 19 February 2008.
Accepted: 25 March 2008.
REFERENCES
This article has been cited by other articles:
|
|
 |
|
  Z. He, M. Kokkinaki, D. Pant, G I. Gallicano, and M. Dym Small RNA molecules in the regulation of spermatogenesis Reproduction, June 1, 2009; 137(6): 901 - 911. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Yu and N. B. Hecht The DNA/RNA-Binding Protein, Translin, Binds microRNA122a and Increases Its In Vivo Stability J Androl, September 1, 2008; 29(5): 572 - 579. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
